nfya

Ensembl ID:
ENSDARG00000042004
ZFIN ID:
ZDB-GENE-010501-1
Description:
nuclear transcription factor Y, alpha [Source:RefSeq peptide;Acc:NP_001076264]
Human Orthologue:
NFYA
Human Description:
nuclear transcription factor Y, alpha [Source:HGNC Symbol;Acc:7804]
Mouse Orthologue:
Nfya
Mouse Description:
nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10216 Nonsense Available for shipment Available now
sa15592 Nonsense Available for shipment Available now
sa2607 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa10216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099571 Nonsense 59 265 3 8
ENSDART00000103064 Nonsense 59 321 3 8
ENSDART00000122531 Nonsense 72 167 4 6
ENSDART00000125616 Nonsense 83 316 4 9
ENSDART00000140397   None 218 None 6
Genomic Location (Zv9):
Chromosome 11 (position 37106509)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36003737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCACTTCCTCTGGGCAGCCCATAATGGTTCAGGCCATGACARGAGGA[C/T]AAGRTCAAACCATTATGCAAGTACCGGTATCTGGTACACAGGGGCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099571 Nonsense 79 265 4 8
ENSDART00000103064 Nonsense 79 321 4 8
ENSDART00000122531 Nonsense 92 167 5 6
ENSDART00000125616 Nonsense 103 316 5 9
ENSDART00000140397   None 218 None 6
Genomic Location (Zv9):
Chromosome 11 (position 37104747)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36001975
KASP Assay ID:
2260-4556.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNTACTGGGGATGAAGTTATAATGAAAANCCTCTATGTTACACAGATTCAGT[T/A]GGTYCAGCCTGGTCAGATTSAGCTTCCTGGTGGACAGACTTTACAGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2607
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099571 Nonsense 239 265 7 8
ENSDART00000103064 Nonsense 239 321 7 8
ENSDART00000122531   None 167 None 6
ENSDART00000125616 Nonsense 263 316 8 9
ENSDART00000140397 Nonsense 137 218 4 6
Genomic Location (Zv9):
Chromosome 11 (position 37101670)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35998898
KASP Assay ID:
554-3133.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGGAGCAGAGATGTTGGAGGAGGAACCTTTGTATGTTAATGCAAAA[C/T]AGTATCACCGGATACTCAAGAGGAGACAAGCTCGCGCCAAACTGGAGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link