si:ch211-63o20.7

Ensembl ID:
ENSDARG00000042000
ZFIN ID:
ZDB-GENE-041001-194
Description:
hypothetical protein LOC566836 [Source:RefSeq peptide;Acc:NP_001038586]
Human Orthologues:
PDIK1L, STK35
Human Descriptions:
PDLIM1 interacting kinase 1 like [Source:HGNC Symbol;Acc:18981]
serine/threonine kinase 35 [Source:HGNC Symbol;Acc:16254]
Mouse Orthologues:
Pdik1l, Stk35
Mouse Descriptions:
PDLIM1 interacting kinase 1 like Gene [Source:MGI Symbol;Acc:MGI:2385213]
serine/threonine kinase 35 Gene [Source:MGI Symbol;Acc:MGI:1914583]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17026 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061555 Essential Splice Site 205 357 2 4
Genomic Location (Zv9):
Chromosome 20 (position 34733460)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34805973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAGATAATGTTCTCGTCTGTCTWACTAAAGAGGGACCAGTCATGAAG[G/A]TACAAATTGYATACGYTARTATTTCACAGATYATGGTGTTACAAGCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link