lztfl1

Ensembl ID:
ENSDARG00000041997
ZFIN ID:
ZDB-GENE-030131-945
Description:
leucine zipper transcription factor-like protein 1 [Source:RefSeq peptide;Acc:NP_955881]
Human Orthologue:
LZTFL1
Human Description:
leucine zipper transcription factor-like 1 [Source:HGNC Symbol;Acc:6741]
Mouse Orthologue:
Lztfl1
Mouse Description:
leucine zipper transcription factor-like 1 Gene [Source:MGI Symbol;Acc:MGI:1934860]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2127 Nonsense Confirmed mutation in F2 line Unknown
sa9216 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu2127
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061544 Nonsense 68 298 3 10
ENSDART00000136357 Nonsense 68 247 2 7
ENSDART00000137245 Nonsense 68 298 2 9

The following transcripts of ENSDARG00000041997 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 11949094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACGAGGTGACTGATATTCTAAATGGGCTTCAGGTTTTGGTGCGTGGA[G/T]AAGTGGAGATGGAACTCATAAACACAGCTCACACTAACGTGCTGCTGCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061544 Nonsense 113 298 4 10
ENSDART00000136357 Nonsense 113 247 3 7
ENSDART00000137245 Nonsense 113 298 3 9

The following transcripts of ENSDARG00000041997 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 11910909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAATAAAATCTCTCTCCCTCTCACTCTTTTATTAGAGAGTTGCTGGAG[C/T]AAGTAGCTGAGTTTGAGAAGACTGATTTCAAACCCAACATCAAGGTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zxuoth7p