rrp9

Ensembl ID:
ENSDARG00000041991
ZFIN ID:
ZDB-GENE-060427-1
Description:
U3 small nucleolar RNA-interacting protein 2 [Source:RefSeq peptide;Acc:NP_001112367]
Human Orthologue:
RRP9
Human Description:
ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast) [Source:HGNC S
Mouse Orthologue:
Rrp9
Mouse Description:
RRP9, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2384

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41886 Nonsense Mutation detected in F1 DNA During 2016
sa10382 Essential Splice Site Available for shipment Available now
sa21955 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065647 Nonsense 39 471 2 15
ENSDART00000135888 Nonsense 39 468 2 15
Genomic Location:
Chromosome 11 (position 37070602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGAGTAATACAGACGACGGCAAAGGGAGATCCAAAAGGTTCAGTAAA[C/T]GAATGAATGAAGAAATCTCGAGTGACTCAGAAAATGAAAGGTAATGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065647 Essential Splice Site 238 471 8 15
ENSDART00000135888 Essential Splice Site 238 468 8 15
Genomic Location:
Chromosome 11 (position 37063459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATGTAAACATYTRTTCAAGTTTAMAGGACACAGAGGTGCCATATCGG[T/A]GAGTAAACAAATAYGAATATGTTTTCYCAGACCAGTTGTTTTGAATGRAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065647 Nonsense 244 471 9 15
ENSDART00000135888 Nonsense 244 468 9 15
Genomic Location:
Chromosome 11 (position 37063294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTTTCTCATGGTCTTAAAAACTTTCTCGGCAGGGTTTGGCTTTTAGA[C/T]GAGGGACTCATACTCTCTACAGTGCGTCACATGACCGCTCCATTAAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link