rrp9

Ensembl ID:
ENSDARG00000041991
ZFIN ID:
ZDB-GENE-060427-1
Description:
U3 small nucleolar RNA-interacting protein 2 [Source:RefSeq peptide;Acc:NP_001112367]
Human Orthologue:
RRP9
Human Description:
ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast) [Source:HGNC S
Mouse Orthologue:
Rrp9
Mouse Description:
RRP9, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2384

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10382 Essential Splice Site Available for shipment Available now
sa21955 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065647 Essential Splice Site 238 471 8 15
ENSDART00000135888 Essential Splice Site 238 468 8 15
Genomic Location:
Chromosome 11 (position 37063459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATGTAAACATYTRTTCAAGTTTAMAGGACACAGAGGTGCCATATCGG[T/A]GAGTAAACAAATAYGAATATGTTTTCYCAGACCAGTTGTTTTGAATGRAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065647 Nonsense 244 471 9 15
ENSDART00000135888 Nonsense 244 468 9 15
Genomic Location:
Chromosome 11 (position 37063294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTTTCTCATGGTCTTAAAAACTTTCTCGGCAGGGTTTGGCTTTTAGA[C/T]GAGGGACTCATACTCTCTACAGTGCGTCACATGACCGCTCCATTAAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mgj3vl25