selo

Ensembl ID:
ENSDARG00000041951
ZFIN ID:
ZDB-GENE-030131-4485
Description:
selenoprotein O [Source:RefSeq peptide;Acc:NP_001038336]
Human Orthologue:
RP3-402G11.5
Human Description:
Selenoprotein O [Source:UniProtKB/Swiss-Prot;Acc:Q9BVL4]
Mouse Orthologue:
1300018J18Rik
Mouse Description:
RIKEN cDNA 1300018J18 gene Gene [Source:MGI Symbol;Acc:MGI:1919007]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2956 Nonsense F2 line generated During 2017
sa36598 Nonsense Mutation detected in F1 DNA During 2017
sa36597 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2956
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099701 Nonsense 43 689 1 9

The following transcripts of ENSDARG00000041951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 14464895)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14910313
KASP Assay ID:
554-2707.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCGGGAATGGACGACATGGGCGTAAGCCTGAGCCGCTCTTCCCTTGAA[C/T]GACTCGAGTTTGACAATGTTGCTCTTAAAAAACTYCCTCTGGACCCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099701 Nonsense 557 689 7 9

The following transcripts of ENSDARG00000041951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 14453136)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14898554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGAGCTGATGGACACCACTGAAGAACAGCTGAGGGTCAAGCACACT[G/T]AACACTGGTCCGACTGGATCCAAAAATACAGGTACAGACGTGGCTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099701 Essential Splice Site 619 689 8 9

The following transcripts of ENSDARG00000041951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 14452452)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14897870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCGCCCAGAATGCAATAGCAGCAGCTGAAAATGGAGACTTCTCAGAG[G/T]TGAGGCTTCATTAGCTTGTTATTCATAGCTTCTAAATTGTAATTTTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link