dlg4

Ensembl ID:
ENSDARG00000041926
Human Orthologue:
DLG4
Human Description:
discs, large homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:2903]
Mouse Orthologue:
Dlg4
Mouse Description:
discs, large homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1277959]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33773 Nonsense Mutation detected in F1 DNA During 2017
sa14583 Nonsense Available for shipment Available now
sa31490 Essential Splice Site Available for shipment Available now
sa33772 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048432 Nonsense 170 691 5 20
Genomic Location (Zv9):
Chromosome 5 (position 71459827)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67785513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTATGTCACCAAAATCATCGAAGGAGGAGCGGCTCATAAAGACGGA[C/T]GACTACAGATTGGAGACAAGATTCTGGCGGTATGATGACACACACATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048432 Nonsense 266 691 7 20
Genomic Location (Zv9):
Chromosome 5 (position 71454301)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67779987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCTCACTCCCACCTCACCGAGCCGCTTTTCTCCTGTGCTGCATGGCT[T/A]GTTGGGAGACGACGACTTACCCAGGTAAAGCTTTMGGATAACTGGAAGAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048432 Essential Splice Site 454 691 11 20
Genomic Location (Zv9):
Chromosome 5 (position 71446823)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67772509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGAGTCAGTCCTCAGGGGGACGAGGAGGAGGTCGGCTTCATCCCCA[G/T]CAAGAGGAGGTTTGTGTGTGTGTGTGTGTGCGTGTGTGTCTGTCTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048432 Essential Splice Site 531 691 17 20
Genomic Location (Zv9):
Chromosome 5 (position 71435493)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67761179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTACACGTTTGAATAGAATCACGAGATGATATCTTTACTGTTCTTC[A/G]GATACGACACGACCCAAGCGGGAGTATGAGGTGGATGGACGGGACTACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link