cryba2b

Ensembl ID:
ENSDARG00000041925
ZFIN ID:
ZDB-GENE-040718-324
Description:
crystallin, beta A2b [Source:RefSeq peptide;Acc:NP_001002584]
Human Orthologue:
CRYBA2
Human Description:
crystallin, beta A2 [Source:HGNC Symbol;Acc:2395]
Mouse Orthologue:
Cryba2
Mouse Description:
crystallin, beta A2 Gene [Source:MGI Symbol;Acc:MGI:104336]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17130 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061442 Essential Splice Site 149 197 None 5
ENSDART00000127942 Essential Splice Site 149 197 None 5

The following transcripts of ENSDARG00000041925 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 11831551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCTGGTGCAGCAAGGAGGTTCCCTCAATCAAAGTCAACTCTGGAGCG[T/G]AAGTYAMTTCCCCAGCCTTTCTGAACRCAYTCTATATGYTATTATATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d7byeiz2