si:dkey-217m5.3

Ensembl ID:
ENSDARG00000041919
ZFIN ID:
ZDB-GENE-041014-320
Description:
hypothetical protein LOC794050 [Source:RefSeq peptide;Acc:NP_001076365]
Human Orthologues:
CCL11, CCL13, CCL15, CCL16, CCL2, CCL23, CCL24, CCL26, CCL7, CCL8
Human Descriptions:
chemokine (C-C motif) ligand 11 [Source:HGNC Symbol;Acc:10610]
chemokine (C-C motif) ligand 13 [Source:HGNC Symbol;Acc:10611]
chemokine (C-C motif) ligand 15 [Source:HGNC Symbol;Acc:10613]
chemokine (C-C motif) ligand 16 [Source:HGNC Symbol;Acc:10614]
chemokine (C-C motif) ligand 2 [Source:HGNC Symbol;Acc:10618]
chemokine (C-C motif) ligand 23 [Source:HGNC Symbol;Acc:10622]
chemokine (C-C motif) ligand 24 [Source:HGNC Symbol;Acc:10623]
chemokine (C-C motif) ligand 26 [Source:HGNC Symbol;Acc:10625]
chemokine (C-C motif) ligand 7 [Source:HGNC Symbol;Acc:10634]
chemokine (C-C motif) ligand 8 [Source:HGNC Symbol;Acc:10635]
Mouse Orthologues:
Ccl11, Ccl12, Ccl2, Ccl24, Ccl26, Ccl6, Ccl7, Ccl8, Ccl9
Mouse Descriptions:
chemokine (C-C motif) ligand 11 Gene [Source:MGI Symbol;Acc:MGI:103576]
chemokine (C-C motif) ligand 12 Gene [Source:MGI Symbol;Acc:MGI:108224]
chemokine (C-C motif) ligand 2 Gene [Source:MGI Symbol;Acc:MGI:98259]
chemokine (C-C motif) ligand 24 Gene [Source:MGI Symbol;Acc:MGI:1928953]
chemokine (C-C motif) ligand 26 Gene [Source:MGI Symbol;Acc:MGI:3589281]
chemokine (C-C motif) ligand 6 Gene [Source:MGI Symbol;Acc:MGI:98263]
chemokine (C-C motif) ligand 7 Gene [Source:MGI Symbol;Acc:MGI:99512]
chemokine (C-C motif) ligand 8 Gene [Source:MGI Symbol;Acc:MGI:101878]
chemokine (C-C motif) ligand 9 Gene [Source:MGI Symbol;Acc:MGI:104533]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44948 Nonsense Mutation detected in F1 DNA During 2017
sa43506 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061434 Nonsense 59 136 3 4
ENSDART00000142164 Nonsense 26 103 2 3
Genomic Location (Zv9):
Chromosome 20 (position 39357828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGCAGGTATATTAACAAAAGTTTTACATTTATTTTTCTGCAGGGTCA[C/T]AGGGTCCTGAAAAGTGCTGCTTTTCTTTTACCAATGCAAGAATTCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061434 Essential Splice Site 94 136 4 4
ENSDART00000142164 Essential Splice Site 61 103 3 3
Genomic Location (Zv9):
Chromosome 20 (position 39357634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39430046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATTTGGTTTTGTGAAATAAAGAAAAATCTTTTCTTTTGAAAATGCA[G/T]TTTCATCATAAGGGCTCAAAGGGAGATCTGCACTAATCCAACTGAGAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link