
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-245h14.2
- Ensembl ID:
- ENSDARG00000041910
- ZFIN ID:
- ZDB-GENE-041014-346
- Description:
- Novel protein similar to human zinc finger protein 512 (ZNF512) [Source:UniProtKB/TrEMBL;Acc:Q5RHA4]
- Human Orthologue:
- ZNF512
- Human Description:
- zinc finger protein 512 [Source:HGNC Symbol;Acc:29380]
- Mouse Orthologue:
- Zfp512
- Mouse Description:
- zinc finger protein 512 Gene [Source:MGI Symbol;Acc:MGI:1917345]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5956 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa25143 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa3063 | Nonsense | F2 line generated | During 2018 |
sa13791 | Nonsense | Available for shipment | Available now |
sa39297 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5956
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061413 | Nonsense | 129 | 374 | 5 | 11 |
ENSDART00000147787 | Nonsense | 116 | 418 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 38556768)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 38629180 GRCz11 20 38532059 - KASP Assay ID:
- 554-3648.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATGGTTTGTTCTAGGGCTGCACTGGAAGTTTCACTAGTATAATGGGTTA[T/A]GTATACMATATGAAGAAATGTGGCAAAGAGTCGTCCGAGCTGGAGAAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25143
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061413 | Nonsense | 157 | 374 | 5 | 11 |
ENSDART00000147787 | Nonsense | 144 | 418 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 38556852)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 38629264 GRCz11 20 38532143 - KASP Assay ID:
- 554-7705.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCGAGCTGGAGAAACTTTTATTGAATTGTAAACACTGTGGAAAAGCATA[T/A]CGTTCCAGAGCGGGCCTGGAGTATCATCTCAAAAATGAACACAGTCCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3063
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061413 | Nonsense | 227 | 374 | 6 | 11 |
ENSDART00000147787 | Nonsense | 214 | 418 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 38557156)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 38629568 GRCz11 20 38532447 - KASP Assay ID:
- 554-2774.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGAAATCGCCAGCGAGGAGCTGCTAAAGGAATGGCCCAAAAGAAAAGTC[C/T]AACGAGACCTGGTGCCAGATGACAGGAAGGTGCTGCAAAATATACACATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13791
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061413 | Nonsense | 228 | 374 | 6 | 11 |
ENSDART00000147787 | Nonsense | 215 | 418 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 38557159)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 38629571 GRCz11 20 38532450 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAATCGCCAGCGAGGAGCTGCTAAAGGAATGGCCCAAAAGAAAAGTCYAA[C/T]GAGACCTGGTGCCAGATGACAGGAAGGTGCTGCAAAATATACACATCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39297
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061413 | None | 374 | None | 11 | |
ENSDART00000147787 | Nonsense | 387 | 418 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 38563001)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 38635413 GRCz11 20 38538292 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCACAGCGACTCAAGAACTGAAAATGAAGAGGAAAGAGAGACGAAACCAA[C/T]AGAAACGGAAAGCAAGCGGACAGGAGAAAGACTGCTATGAATTCAGTGGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)
- Waist Circumference - Triglycerides (WC-TG): A bivariate genome-wide approach to metabolic syndrome: STAMPEED consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: