si:ch211-245h14.2

Ensembl ID:
ENSDARG00000041910
ZFIN ID:
ZDB-GENE-041014-346
Description:
Novel protein similar to human zinc finger protein 512 (ZNF512) [Source:UniProtKB/TrEMBL;Acc:Q5RHA4]
Human Orthologue:
ZNF512
Human Description:
zinc finger protein 512 [Source:HGNC Symbol;Acc:29380]
Mouse Orthologue:
Zfp512
Mouse Description:
zinc finger protein 512 Gene [Source:MGI Symbol;Acc:MGI:1917345]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5956 Nonsense Mutation detected in F1 DNA During 2017
sa25143 Nonsense Mutation detected in F1 DNA During 2017
sa3063 Nonsense F2 line generated During 2017
sa13791 Nonsense Available for shipment Available now
sa39297 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 129 374 5 11
ENSDART00000147787 Nonsense 116 418 4 9
Genomic Location (Zv9):
Chromosome 20 (position 38556768)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629180
KASP Assay ID:
554-3648.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGTTTGTTCTAGGGCTGCACTGGAAGTTTCACTAGTATAATGGGTTA[T/A]GTATACMATATGAAGAAATGTGGCAAAGAGTCGTCCGAGCTGGAGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 157 374 5 11
ENSDART00000147787 Nonsense 144 418 4 9
Genomic Location (Zv9):
Chromosome 20 (position 38556852)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629264
KASP Assay ID:
554-7705.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGAGCTGGAGAAACTTTTATTGAATTGTAAACACTGTGGAAAAGCATA[T/A]CGTTCCAGAGCGGGCCTGGAGTATCATCTCAAAAATGAACACAGTCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3063
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 227 374 6 11
ENSDART00000147787 Nonsense 214 418 5 9
Genomic Location (Zv9):
Chromosome 20 (position 38557156)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629568
KASP Assay ID:
554-2774.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAATCGCCAGCGAGGAGCTGCTAAAGGAATGGCCCAAAAGAAAAGTC[C/T]AACGAGACCTGGTGCCAGATGACAGGAAGGTGCTGCAAAATATACACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 228 374 6 11
ENSDART00000147787 Nonsense 215 418 5 9
Genomic Location (Zv9):
Chromosome 20 (position 38557159)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCGCCAGCGAGGAGCTGCTAAAGGAATGGCCCAAAAGAAAAGTCYAA[C/T]GAGACCTGGTGCCAGATGACAGGAAGGTGCTGCAAAATATACACATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413   None 374 None 11
ENSDART00000147787 Nonsense 387 418 9 9
Genomic Location (Zv9):
Chromosome 20 (position 38563001)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38635413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGCGACTCAAGAACTGAAAATGAAGAGGAAAGAGAGACGAAACCAA[C/T]AGAAACGGAAAGCAAGCGGACAGGAGAAAGACTGCTATGAATTCAGTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link