dnajc5g

Ensembl ID:
ENSDARG00000041896
ZFIN ID:
ZDB-GENE-030131-1583
Description:
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma [Source:RefSeq peptide;Acc:NP_955917]
Human Orthologue:
DNAJC5G
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma [Source:HGNC Symbol;Acc:24844]
Mouse Orthologue:
Dnajc5g
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma Gene [Source:MGI Symbol;Acc:MGI:3045263]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37120 Nonsense Mutation detected in F1 DNA During 2017
sa39300 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061393 Nonsense 111 199 3 6
ENSDART00000136771 Nonsense 111 199 3 5
Genomic Location (Zv9):
Chromosome 20 (position 38801108)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38873520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTGGAGAAGAAAGTGTCAAATACTACTTCCTCATGTCAAAGTGGTG[G/A]TTCAAGGTGAGAGCTAGTTTTCATATAAGCAGAGCTGTTATTTACTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061393 Essential Splice Site None 199 None 6
ENSDART00000136771   None 199 5 5
Genomic Location (Zv9):
Chromosome 20 (position 38790405)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38862817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTAATGTAGTGTGCTTATCGCTGGACATCACGGCACCAGGACTAAAC[T/G]GTGCCACTTGCGCCACACCCTGACTCTGACCCACTGGAAACGAGTGGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link