cad

Ensembl ID:
ENSDARG00000041895
ZFIN ID:
ZDB-GENE-021030-4
Description:
CAD protein [Source:RefSeq peptide;Acc:NP_001009884]
Human Orthologue:
CAD
Human Description:
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase [Source:HGNC Symbol
Mouse Orthologue:
Cad
Mouse Description:
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase Gene [Source:MGI Sy

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11882 Essential Splice Site Available for shipment Available now
sa4096 Nonsense Mutation detected in F1 DNA During 2014
sa4105 Nonsense Mutation detected in F1 DNA During 2014
sa23778 Nonsense Mutation detected in F1 DNA During 2014
sa9368 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361 Essential Splice Site None 513 None 44
ENSDART00000061365 Essential Splice Site 165 2230 None 43
ENSDART00000075262 Essential Splice Site 169 2154 None 41
ENSDART00000122056 Essential Splice Site 165 261 None 9
ENSDART00000125333 None None 485 None 11
Genomic Location:
Chromosome 20 (position 38847528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGACAATCCAGAYGCCCGAAACCTTGTTAAAGAAGTTTCYATGAAAG[T/A]AGGTGTCTAGCTTCAGTGTTTTTTAGATGGATGATGTTGTGTAATGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361 None None 513 10 44
ENSDART00000061365 Nonsense 427 2230 10 43
ENSDART00000075262 Nonsense 427 2154 10 41
ENSDART00000122056 None None 261 None 9
ENSDART00000125333 None None 485 None 11
Genomic Location:
Chromosome 20 (position 38844210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATGTATGTTTGTCTTCTTTTTTCAACCAGGCTATAAAAGCTATGAAA[G/T]AAGAGAATATCCAAACCATTCTCATCAACCCAAACATTGCCACAGTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361 None None 513 13 44
ENSDART00000061365 Nonsense 679 2230 13 43
ENSDART00000075262 Nonsense 679 2154 13 41
ENSDART00000122056 None None 261 None 9
ENSDART00000125333 None None 485 None 11
Genomic Location:
Chromosome 20 (position 38842480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTGTGGGAGAGTGCAACATTCAGTATGCCCTGAATCCTGAATCAGAG[C/T]AGGTGATTTAGTCTTTTATATCTTCCAATAATAAGCTTTAAAAGGTRCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361 None None 513 27 44
ENSDART00000061365 Nonsense 1465 2230 27 43
ENSDART00000075262 Nonsense 1465 2154 27 41
ENSDART00000122056 None None 261 None 9
ENSDART00000125333 None None 485 None 11
Genomic Location:
Chromosome 20 (position 38828264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTGGACAGGCTCCTCGCGTGAAGACACATGTAGACAGCATGACCTCA[C/T]AGAAACTCATCCGTTTGCCAGGTAAGTGTGGTCTCTTGCATCCTTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361 None None 513 44 44
ENSDART00000061365 Nonsense 2228 2230 43 43
ENSDART00000075262 None 2148 2154 41 41
ENSDART00000122056 None None 261 None 9
ENSDART00000125333 None None 485 None 11
Genomic Location:
Chromosome 20 (position 38813613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGCAGAGAACGGGATGTATATTCGGATGGCACTACTGGCTACTGTAT[T/A]GGGGCGATGAAGGGACYATAATGGTTCAGTCTTGACATTTGGCARTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7cyu7gtd