cad

Ensembl ID:
ENSDARG00000041895
ZFIN ID:
ZDB-GENE-021030-4
Description:
CAD protein [Source:RefSeq peptide;Acc:NP_001009884]
Human Orthologue:
CAD
Human Description:
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase [Source:HGNC Symbol
Mouse Orthologue:
Cad
Mouse Description:
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase Gene [Source:MGI Sy

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11882 Essential Splice Site Available for shipment Available now
sa37122 Nonsense Mutation detected in F1 DNA During 2016
sa23778 Nonsense Mutation detected in F1 DNA During 2016
sa37121 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9368 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361 Essential Splice Site None 513 None 44
ENSDART00000061365 Essential Splice Site 165 2230 None 43
ENSDART00000075262 Essential Splice Site 169 2154 None 41
ENSDART00000122056 Essential Splice Site 165 261 None 9
ENSDART00000125333   None 485 None 11
Genomic Location (Zv9):
Chromosome 20 (position 38847528)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38919940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGACAATCCAGAYGCCCGAAACCTTGTTAAAGAAGTTTCYATGAAAG[T/A]AGGTGTCTAGCTTCAGTGTTTTTTAGATGGATGATGTTGTGTAATGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361   None 513 22 44
ENSDART00000061365 Nonsense 1168 2230 22 43
ENSDART00000075262 Nonsense 1168 2154 22 41
ENSDART00000122056   None 261 None 9
ENSDART00000125333   None 485 None 11
Genomic Location (Zv9):
Chromosome 20 (position 38833056)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38905468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGCCATCGCGGTTTCTGAGCATGTGGAGAACGCAGGGGTTCATTCT[G/T]GAGACGCCACACTGGTGACTCCTCCACAGGACATTAACCAGAAAACCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361   None 513 27 44
ENSDART00000061365 Nonsense 1465 2230 27 43
ENSDART00000075262 Nonsense 1465 2154 27 41
ENSDART00000122056   None 261 None 9
ENSDART00000125333   None 485 None 11
Genomic Location (Zv9):
Chromosome 20 (position 38828264)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38900676
KASP Assay ID:
2261-4751.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTGGACAGGCTCCTCGCGTGAAGACACATGTAGACAGCATGACCTCA[C/T]AGAAACTCATCCGTTTGCCAGGTAAGTGTGGTCTCTTGCATCCTTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361 Essential Splice Site 327 513 36 44
ENSDART00000061365   None 2230 None 43
ENSDART00000075262   None 2154 None 41
ENSDART00000122056   None 261 None 9
ENSDART00000125333 Essential Splice Site 299 485 7 11
Genomic Location (Zv9):
Chromosome 20 (position 38822743)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38895155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATATGCAGGTTTCAAAAGATCTACCATGCATCCCCAAAAGGCGTTTGG[T/A]AATGTGATGTGTATAGTTTTATCAAATCAAGATCTGTGTCTCGTGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061361   None 513 44 44
ENSDART00000061365 Nonsense 2228 2230 43 43
ENSDART00000075262   2148 2154 41 41
ENSDART00000122056   None 261 None 9
ENSDART00000125333   None 485 None 11
Genomic Location (Zv9):
Chromosome 20 (position 38813613)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38886025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGCAGAGAACGGGATGTATATTCGGATGGCACTACTGGCTACTGTAT[T/A]GGGGCGATGAAGGGACYATAATGGTTCAGTCTTGACATTTGGCARTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link