tnfrsf19

Ensembl ID:
ENSDARG00000041869
ZFIN ID:
ZDB-GENE-030131-6760
Description:
tumor necrosis factor receptor superfamily member 19 [Source:RefSeq peptide;Acc:NP_001038369]
Human Orthologue:
TNFRSF19
Human Description:
tumor necrosis factor receptor superfamily, member 19 [Source:HGNC Symbol;Acc:11915]
Mouse Orthologue:
Tnfrsf19
Mouse Description:
tumor necrosis factor receptor superfamily, member 19 Gene [Source:MGI Symbol;Acc:MGI:1352474]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3933 Essential Splice Site Mutation detected in F1 DNA During 2014
sa742 Nonsense Available for shipment Available now
sa6139 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061351 Essential Splice Site 202 356 6 10
ENSDART00000143880 None None 120 None 4
Genomic Location:
Chromosome 15 (position 8321233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCTCTGTGTGATCTACTGTAAGAGACAGCTGCTGGAGAAGAAACCAG[G/A]TGAAACACAGCWGACACATCCACTTSAGACTAGCAGATTGATTTCGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061351 Nonsense 306 356 9 10
ENSDART00000143880 None None 120 None 4
ENSDART00000061351 Nonsense 306 356 9 10
ENSDART00000143880 None None 120 None 4
Genomic Location:
Chromosome 15 (position 8316567)
KASP Assay ID:
554-0649.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGATATGGCYTGTGCTCCTGATGAAGTCTGGCCRCTCGTTCAGTCC[A/T]GMAGAACCACAGACAGTCTCCAGACCAACCAGAGGTGCTCCTCAWGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061351 Nonsense 306 356 9 10
ENSDART00000143880 None None 120 None 4
ENSDART00000061351 Nonsense 306 356 9 10
ENSDART00000143880 None None 120 None 4
Genomic Location:
Chromosome 15 (position 8316567)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGATATGGCYTGTGCTCCTGATGAAGTCTGGCCRCTCGTTCAGTCC[A/T]GMAGAACCACAGACAGTCTCCAGACCAACCAGAGGTGCTCCTCAWGTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wk3ptj1u