gnrhr1

Ensembl ID:
ENSDARG00000041866
ZFIN ID:
ZDB-GENE-090128-2
Description:
gonadotropin releasing hormone receptor 1 [Source:RefSeq peptide;Acc:NP_001138452]
Human Orthologues:
GNRHR, GNRHR2
Human Descriptions:
gonadotropin-releasing hormone (type 2) receptor 2 [Source:HGNC Symbol;Acc:16341]
gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
Mouse Orthologue:
Gnrhr
Mouse Description:
gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24785 Nonsense Available for shipment Available now
sa24784 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Nonsense 289 377 3 3
Genomic Location:
Chromosome Zv9_NA22 (position 30721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTGTGGTGTGCTGGACACCGTATTATCTGCTGGGCATCTGGTATTG[G/A]TTTCAGCCCCGAATGCTGCAGGTCACGCCGGAATACGTCCATCACGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Nonsense 329 377 3 3
Genomic Location:
Chromosome Zv9_NA22 (position 30603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACACGTGCTGTGATCCGGTCATCTACGGTTTCTTCACACCCTCGTTC[A/T]GAGCAGACATAACCAGCTGCTTCAGTAGGAGGAATCAAAACTGCTCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/846jqkoz