gnrhr1

Ensembl ID:
ENSDARG00000041866
ZFIN ID:
ZDB-GENE-090128-2
Description:
gonadotropin releasing hormone receptor 1 [Source:RefSeq peptide;Acc:NP_001138452]
Human Orthologues:
GNRHR, GNRHR2
Human Descriptions:
gonadotropin-releasing hormone (type 2) receptor 2 [Source:HGNC Symbol;Acc:16341]
gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
Mouse Orthologue:
Gnrhr
Mouse Description:
gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30447 Essential Splice Site Mutation detected in F1 DNA During 2015
sa24785 Nonsense Available for shipment Available now
sa24784 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa30447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Essential Splice Site 174 377 2 3
Genomic Location:
Chromosome Zv9_NA22 (position 33220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACAGCACAAAATAAAAACTGATCTTTACAAATTGTTTTTCTCGTTTC[A/C]GTTATTTATTTTCAGGGCAATTAAAGCTGAAGGAGTTGACTTTGTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Nonsense 289 377 3 3
Genomic Location:
Chromosome Zv9_NA22 (position 30721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTGTGGTGTGCTGGACACCGTATTATCTGCTGGGCATCTGGTATTG[G/A]TTTCAGCCCCGAATGCTGCAGGTCACGCCGGAATACGTCCATCACGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Nonsense 329 377 3 3
Genomic Location:
Chromosome Zv9_NA22 (position 30603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACACGTGCTGTGATCCGGTCATCTACGGTTTCTTCACACCCTCGTTC[A/T]GAGCAGACATAACCAGCTGCTTCAGTAGGAGGAATCAAAACTGCTCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/846jqkoz