capn3

Ensembl ID:
ENSDARG00000041864
ZFIN ID:
ZDB-GENE-040912-97
Description:
calpain-3 [Source:RefSeq peptide;Acc:NP_001004571]
Human Orthologue:
CAPN3
Human Description:
calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
Mouse Orthologue:
Capn3
Mouse Description:
calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36511 Nonsense Mutation detected in F1 DNA During 2016
sa23173 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103468 Nonsense 3 725 1 21
Genomic Location (Zv9):
Chromosome 17 (position 45472738)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45191920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGTGTTTTCAATCCCTTAAAAAAAAAACAGTGAGACAAGATGCCCTA[T/A]ACGCCGTCTGGGTTCTTCTGCGACCGTTTAATTCGGGAGAGGGAGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103468 Essential Splice Site 445 725 11 21
Genomic Location (Zv9):
Chromosome 17 (position 45495584)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45344816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAATACAACCATATTCCATCCCATTTAATTCTTCCCTTTTTTCCGTA[G/A]GTGCCAAAGGAGGTATGAAAATGTTAAGAAGACTGTTTGGACCCAAGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link