capn3

Ensembl ID:
ENSDARG00000041864
ZFIN ID:
ZDB-GENE-040912-97
Description:
calpain-3 [Source:RefSeq peptide;Acc:NP_001004571]
Human Orthologue:
CAPN3
Human Description:
calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
Mouse Orthologue:
Capn3
Mouse Description:
calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23173 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2938 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103468 Essential Splice Site 445 725 11 21
Genomic Location:
Chromosome 17 (position 45495584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAATACAACCATATTCCATCCCATTTAATTCTTCCCTTTTTTCCGTA[G/A]GTGCCAAAGGAGGTATGAAAATGTTAAGAAGACTGTTTGGACCCAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103468 Essential Splice Site 609 725 16 21
Genomic Location:
Chromosome 17 (position 45503873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAGAGCTTCAGTCGAGAGTGCTGTAGAAGCATGATTGCCCTCATGGAC[G/A]TATCCTTTGTATCAAGTTTGAATGCTCTTGCTATCTGTTTTGAAGGTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ialeq8sg