rbm39b

Ensembl ID:
ENSDARG00000041853
ZFIN ID:
ZDB-GENE-050327-97
Description:
RNA binding motif protein 39b [Source:RefSeq peptide;Acc:NP_001014392]
Human Orthologue:
RBM39
Human Description:
RNA binding motif protein 39 [Source:HGNC Symbol;Acc:15923]
Mouse Orthologue:
Rbm39
Mouse Description:
RNA binding motif protein 39 Gene [Source:MGI Symbol;Acc:MGI:2157953]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14375 Essential Splice Site Available for shipment Available now
sa15085 Nonsense Available for shipment Available now
sa16431 Nonsense Available for shipment Available now
sa17954 Essential Splice Site, Splice Site Available for shipment Available now
sa25402 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061328 Essential Splice Site 17 539 3 17
ENSDART00000075748 Essential Splice Site 17 164 2 7
ENSDART00000098634 Essential Splice Site 17 205 2 7
ENSDART00000140233 Essential Splice Site 17 243 2 8

The following transcripts of ENSDARG00000041853 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38361353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAGACGACTTCGACGTTGAGGCCATGCTAGAAGCTCCTTATAGRAAG[G/A]TGGGTSGGCGACMGGAAGTTACCTGATCTCTTCTCTGTTTTTNNCCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061328 Nonsense 82 539 5 17
ENSDART00000075748 Nonsense 82 164 4 7
ENSDART00000098634 Nonsense 82 205 4 7
ENSDART00000140233 Nonsense 82 243 4 8

The following transcripts of ENSDARG00000041853 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38354158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGCAGCCGTGAGCGGAAGCCTTCACGGAGCAAAGAGCGAAAACGTWCA[C/T]GATCCCGCAGTAAGGATCGCGGTGGACGTAGCCGTGGACGCAAAAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061328 Nonsense 104 539 6 17
ENSDART00000075748 Nonsense 104 164 5 7
ENSDART00000098634 Nonsense 104 205 5 7
ENSDART00000140233 Nonsense 104 243 5 8

The following transcripts of ENSDARG00000041853 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38353493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCGACAAACKGTCATTTTGTCTTTTTGTCACAGTATGGGGCAGAAAT[T/G]AAATGGTGGTCCTGGAGGGAAGACCGGCCCACAACATTTTCCCAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061328 Essential Splice Site 153 539 7 17
ENSDART00000075748 Splice Site None 164 None 7
ENSDART00000098634 Essential Splice Site 153 205 6 7
ENSDART00000140233 Essential Splice Site 153 243 6 8

The following transcripts of ENSDARG00000041853 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38353205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTCAAGAAGGACAAAAGCCCATTYAAGAAGGACAAAAGCCCTGTCAG[G/A]TGAGATGCACATCACTGTCTGCTGAAGTACTGTAGWATTAAAGTATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061328 Nonsense 230 539 9 17
ENSDART00000075748 None None 164 None 7
ENSDART00000098634 None None 205 None 7
ENSDART00000140233 Nonsense 230 243 8 8

The following transcripts of ENSDARG00000041853 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38352561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGTTTGTGGATTCAACATCAGTCCCACTAGCAATCGGCCTCACAGGA[C/T]AGAGGGTGCTTGGAGTGCCTATCATAGTCCAGGCCTCACAGGTCAGAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1gzgijat