rh50

Ensembl ID:
ENSDARG00000041848
ZFIN ID:
ZDB-GENE-000427-1
Description:
Rh50-like protein isoform 2 [Source:RefSeq peptide;Acc:NP_001119916]
Human Orthologues:
RHAG, RHBG, RHCE, RHCG, RHD
Human Descriptions:
Rh blood group, CcEe antigens [Source:HGNC Symbol;Acc:10008]
Rh blood group, D antigen [Source:HGNC Symbol;Acc:10009]
Rh family, B glycoprotein (gene/pseudogene) [Source:HGNC Symbol;Acc:14572]
Rh family, C glycoprotein [Source:HGNC Symbol;Acc:18140]
Rh-associated glycoprotein [Source:HGNC Symbol;Acc:10006]
Mouse Orthologues:
Rhag, Rhbg, Rhcg, Rhd
Mouse Descriptions:
Rh blood group, D antigen Gene [Source:MGI Symbol;Acc:MGI:1202882]
Rhesus blood group-associated A glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1202713]
Rhesus blood group-associated B glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1927379]
Rhesus blood group-associated C glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1888517]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18378 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061327 Nonsense 178 472 2 2
Genomic Location:
Chromosome 8 (position 38372753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGAATGGGCTGTAYTGAAATACCTGAGGATCAATGATGCTGGTGGCT[C/A]GATTCTTATCCACATTTTTGCCTGCTACTTTGGTCTGGGTGTCACATTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ckvi6s3h