tsc22d2

Ensembl ID:
ENSDARG00000041839
ZFIN ID:
ZDB-GENE-031001-12
Description:
TSC22 domain family 2 [Source:RefSeq peptide;Acc:NP_956403]
Human Orthologue:
TSC22D2
Human Description:
TSC22 domain family, member 2 [Source:HGNC Symbol;Acc:29095]
Mouse Orthologue:
Tsc22d2
Mouse Description:
TSC22 domain family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1919283]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14179 Nonsense Available for shipment Available now
sa8884 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061315 Nonsense 378 556 1 3
ENSDART00000146430 Nonsense 378 556 1 3

The following transcripts of ENSDARG00000041839 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 38092210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCYCARAGTGTGCCAAAGCAGAATGCAGCRCCCCAGCAGAACCAGCCT[C/T]AGGGAGTGCCCAGCGGGTCAGTTGTGGGACYGGGTGCACAGATGAGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061315 Essential Splice Site 449 556 1 3
ENSDART00000146430 Essential Splice Site 449 556 1 3

The following transcripts of ENSDARG00000041839 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 38092426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACAGCTTGTTCRGGATCGCCCTTCCCATCGACGGGGACGAGGACAGG[T/C]ACTGCTTTTCTCTCGCTGTCATTGCTCATWYGGGCGTTTGGTTCTTTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiponectin levels: Novel loci for adiponectin levels and their influence on type 2 diabetes and metabolic traits: a multi-ethnic meta-analysis of 45,891 individuals. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/odefq4xj