rnf141

Ensembl ID:
ENSDARG00000041802
ZFIN ID:
ZDB-GENE-040625-71
Description:
RING finger protein 141 [Source:UniProtKB/Swiss-Prot;Acc:Q6IV56]
Human Orthologue:
RNF141
Human Description:
ring finger protein 141 [Source:HGNC Symbol;Acc:21159]
Mouse Orthologue:
Rnf141
Mouse Description:
ring finger protein 141 Gene [Source:MGI Symbol;Acc:MGI:1914400]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36611 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32198 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061265 Essential Splice Site 173 222 5 6
ENSDART00000123898 Essential Splice Site 173 222 4 5
ENSDART00000136320   None 131 None 3
Genomic Location (Zv9):
Chromosome 18 (position 16412631)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16764397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCTTCCCTGTGCGCACAGCTTCTGTCAGAAGTGTATTGACAAGTGG[T/A]AAGAGCTCATCATTTAATAATGACAGTTCTTTTAGTGTTCCTTTATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061265 Nonsense 194 222 6 6
ENSDART00000123898 Nonsense 194 222 5 5
ENSDART00000136320   None 131 None 3
Genomic Location (Zv9):
Chromosome 18 (position 16415133)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16766899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAACTGCCCCGTCTGCCGGATTCAGGTGACTGCCGCTAATGAATCCTG[G/A]GTCATGTCGGATGCTCCCACAGAGGAAGATGTAGCCGGGTACATTCTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link