cx43

Ensembl ID:
ENSDARG00000041799
ZFIN ID:
ZDB-GENE-991105-4
Description:
Gap junction alpha-1 protein [Source:UniProtKB/Swiss-Prot;Acc:O57474]
Human Orthologue:
GJA1
Human Description:
gap junction protein, alpha 1, 43kDa [Source:HGNC Symbol;Acc:4274]
Mouse Orthologues:
Gja1, Gja6
Mouse Descriptions:
gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]
gap junction protein, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:95717]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32313 Nonsense Available for shipment Available now
sa29432 Nonsense Mutation detected in F1 DNA During 2017
sa37126 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047272   None 282 2 3
ENSDART00000061261 Nonsense 7 381 2 2
ENSDART00000138569 Nonsense 7 341 2 3
Genomic Location (Zv9):
Chromosome 20 (position 40749612)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40820771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCTATTTTCAGCTAGAACTCCCTCAAGATGGGTGACTGGAGTGCGT[T/A]GGGAAGGCTTCTTGACAAGGTGCAGGCCTACTCCACGGCCGGAGGGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047272   None 282 3 3
ENSDART00000061261 Nonsense 68 381 2 2
ENSDART00000138569 Nonsense 28 341 3 3
Genomic Location (Zv9):
Chromosome 20 (position 40749430)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40820589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCAAGTGCAATACCCAGCAGCCTGGTTGCGAGAATGTCTGCTATGAC[A/T]AATCGTTCCCCATCTCGCACGTGCGCTTCTGGGTGCTTCAGATCATCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047272 Nonsense 144 282 3 3
ENSDART00000061261 Nonsense 243 381 2 2
ENSDART00000138569 Nonsense 203 341 3 3
Genomic Location (Zv9):
Chromosome 20 (position 40748905)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40820064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGCTCTTCTACGTGCTCTTCAAACGAATCAAGGACCGCGTCAAAAGC[C/T]GACAAAACACACAGTTTCCCACTGGCACTTTGAGCCCCACGCCGAAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link