si:ch73-193m8.2

Ensembl ID:
ENSDARG00000041791
ZFIN ID:
ZDB-GENE-091204-429
Human Orthologue:
MGAT4C
Human Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative) [S
Mouse Orthologue:
Mgat4c
Mouse Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative) Ge

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15529 Essential Splice Site Available for shipment Available now
sa14085 Essential Splice Site Available for shipment Available now
sa23268 Nonsense Available for shipment Available now
sa43072 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Essential Splice Site 6 478 None 4
ENSDART00000143744   None 477 3 5
Genomic Location (Zv9):
Chromosome 18 (position 16050984)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16402750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGTATTTTTTTANNTNCTGTTTTCTGCCAGATYACACCAGAATTGTTTCC[A/T]TCATGAGACTGGTGTTAAAGTACCTGGAWAAGATGAGGTGTTTCCGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Essential Splice Site 50 478 3 4
ENSDART00000143744 Essential Splice Site 44 477 4 5
Genomic Location (Zv9):
Chromosome 18 (position 16050068)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16401834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTCAAAGCTTATGCTGCGATCTGTCTGWCTTGAATGTCATGTGTTTC[A/C]GGARGAAGATAAACGTCAGCTGCGAGAAACCTCAATGCATCCKCTGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Nonsense 159 478 4 4
ENSDART00000143744 Nonsense 153 477 5 5
Genomic Location (Zv9):
Chromosome 18 (position 16047890)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16399656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATTTCGACCTTGCGTGGTGTGAAAGCCTAGTTCAAGAAATCTCCAGA[A/T]AGTTCGGCCACCATATCATTGCGGGACGGCTGCTTGTAATCCATGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Nonsense 249 478 4 4
ENSDART00000143744 Nonsense 243 477 5 5
Genomic Location (Zv9):
Chromosome 18 (position 16047618)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16399384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCACCGCCCTAAAGAAAGTTGTGGCGTCCCGGGAGGGTTCATACTG[G/A]GTGATGCTGGAGTTCTCCAAACTGGGCTACATAGGAAAGCTGTACCACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link