ndst3

Ensembl ID:
ENSDARG00000041776
ZFIN ID:
ZDB-GENE-090312-199
Human Orthologues:
NDST3, NDST4
Human Descriptions:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 [Source:HGNC Symbol;Acc:7682]
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4 [Source:HGNC Symbol;Acc:20779]
Mouse Orthologues:
Ndst3, Ndst4
Mouse Descriptions:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 Gene [Source:MGI Symbol;Acc:MGI:1932544]
N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4 Gene [Source:MGI Symbol;Acc:MGI:1932545]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19475 Nonsense Available for shipment Available now
sa39597 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19474 Essential Splice Site Available for shipment Available now
sa1553 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061232 Nonsense 305 874 1 14
ENSDART00000136145 Nonsense 305 874 1 13
ENSDART00000146084 Nonsense 305 874 2 14
Genomic Location (Zv9):
Chromosome 1 (position 19051070)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19576829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATCGCGTTTTTAACAGGCAGAAAGCTTTCGCGATCTCTGGAGCGCTA[C/A]ATCCTGGTGGACATAGATGATATTTTTGTGGGCAAGAAAGGCACAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061232 Essential Splice Site 649 874 8 14
ENSDART00000136145 Essential Splice Site 649 874 8 13
ENSDART00000146084 Essential Splice Site 649 874 9 14
Genomic Location (Zv9):
Chromosome 1 (position 18908403)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19477318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGTTCAGTTTTTCAACACCAACAACTACCATAAAGGCATCGACTG[G/A]TGGGTGTAAAAACACTTTGGTGCGGGTTTCACTTTGTCGTTTTGGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061232 Essential Splice Site 649 874 9 14
ENSDART00000136145 Essential Splice Site 649 874 9 13
ENSDART00000146084 Essential Splice Site 649 874 10 14
Genomic Location (Zv9):
Chromosome 1 (position 18904789)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19473704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTGTCTTTGTGCGAGTTTCCTCTAACTCGATACACCTCTTTCTCAA[A/G]GGTATATGGAGTTCTTTCCAGTTCCATCTAATGTCAGCACTGATTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061232 Nonsense 865 874 14 14
ENSDART00000136145 Nonsense 865 874 13 13
ENSDART00000146084 Nonsense 865 874 14 14
Genomic Location (Zv9):
Chromosome 1 (position 18885634)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19454549
KASP Assay ID:
554-1496.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGAATTATCTAAGCTGCTGCACAGACTGGGTCAACCGTTACCAGCCTG[G/A]CTCAGAGAAGAGCTCCAGAAGGTCAGGTAGCCCAAACCAAACCAGCGCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Resistin levels : Genome-wide association analysis identifies TYW3/CRYZ and NDST4 loci associated with circulating resistin levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link