si:dkey-174k18.8

Ensembl ID:
ENSDARG00000041728
ZFIN IDs:
ZDB-GENE-030131-7478, ZDB-GENE-030131-7478, ZDB-GENE-070912-390
Description:
Novel protein similar to vertebrate mannosidase, alpha, class 1A, member 2 (MAN1A2) [Source:UniProtK
Human Orthologue:
MAN1A2
Human Description:
mannosidase, alpha, class 1A, member 2 [Source:HGNC Symbol;Acc:6822]
Mouse Orthologue:
Man1a2
Mouse Description:
mannosidase, alpha, class 1A, member 2 Gene [Source:MGI Symbol;Acc:MGI:104676]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2510 Essential Splice Site F2 line generated During 2017
sa15063 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2510
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102192 Essential Splice Site 104 645 1 13
ENSDART00000144248 Essential Splice Site 104 645 2 14
ENSDART00000147435 Essential Splice Site 104 106 2 3
Genomic Location (Zv9):
Chromosome 9 (position 21591610)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20747396
KASP Assay ID:
554-3167.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAGACAGGTCATACATGGTGTGGGAGCTCAYGACGAGCATCGGCACAG[G/A]TAAGAGCTTCAGATTCTCAAACACAACATGCGTTTTCATGTTTAAGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102192 Essential Splice Site 262 645 4 13
ENSDART00000144248 Essential Splice Site 262 645 5 14
ENSDART00000147435   None 106 None 3
Genomic Location (Zv9):
Chromosome 9 (position 21733516)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20889302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAAAGAYGGCCAGGAGTGGATCGAGCAAAACCTGGATTTCAGTGTGG[T/G]AAGTGGCCAAGACACACACAACAACCACCANNNNNNNNACACTTCTCTTTGTAGGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link