csrp2bp

Ensembl ID:
ENSDARG00000041708
ZFIN ID:
ZDB-GENE-040718-452
Description:
cysteine-rich protein 2-binding protein [Source:RefSeq peptide;Acc:NP_001002699]
Human Orthologue:
CSRP2BP
Human Description:
CSRP2 binding protein [Source:HGNC Symbol;Acc:15904]
Mouse Orthologue:
Csrp2bp
Mouse Description:
cysteine and glycine-rich protein 2 binding protein Gene [Source:MGI Symbol;Acc:MGI:1917264]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10298 Nonsense Available for shipment Available now
sa7989 Nonsense Mutation detected in F1 DNA During 2015
sa30730 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa10298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061131 Nonsense 273 782 5 10
ENSDART00000131811 Nonsense 273 782 7 12
Genomic Location:
Chromosome 22 (position 25544731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGCAGCTGAAAGAAAAGCGTTCTCGAACACAAGAGGCAAAAGAGATT[C/T]GACGTGCACAGAAGGAGGCGGCTGGGTTTCTTGACCGCAGTGCCTCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061131 Nonsense 633 782 8 10
ENSDART00000131811 Nonsense 633 782 10 12
Genomic Location:
Chromosome 22 (position 25540023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGARATTCGTGCGCATCACCACAGGAATGACCCGAATTGGGTAGCT[G/T]AACCTGACGCACCTATAGACTACTGCTACGTACGGCCAAATCACATCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061131 Nonsense 656 782 8 10
ENSDART00000131811 Nonsense 656 782 10 12
Genomic Location:
Chromosome 22 (position 25539954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACTGCTACGTACGGCCAAATCACATCCCCTCTGTCAACTCCATGTGC[C/T]AAGACATCTTCTGGCCTGGTAATCATCAGTTCATCCAAACTAATCCATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t8nhkg4y