csrp2bp

Ensembl ID:
ENSDARG00000041708
ZFIN ID:
ZDB-GENE-040718-452
Description:
cysteine-rich protein 2-binding protein [Source:RefSeq peptide;Acc:NP_001002699]
Human Orthologue:
CSRP2BP
Human Description:
CSRP2 binding protein [Source:HGNC Symbol;Acc:15904]
Mouse Orthologue:
Csrp2bp
Mouse Description:
cysteine and glycine-rich protein 2 binding protein Gene [Source:MGI Symbol;Acc:MGI:1917264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10298 Nonsense Available for shipment Available now
sa7989 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061131 Nonsense 273 782 5 10
ENSDART00000131811 Nonsense 273 782 7 12
Genomic Location:
Chromosome 22 (position 25544731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGCAGCTGAAAGAAAAGCGTTCTCGAACACAAGAGGCAAAAGAGATT[C/T]GACGTGCACAGAAGGAGGCGGCTGGGTTTCTTGACCGCAGTGCCTCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061131 Nonsense 633 782 8 10
ENSDART00000131811 Nonsense 633 782 10 12
Genomic Location:
Chromosome 22 (position 25540023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGARATTCGTGCGCATCACCACAGGAATGACCCGAATTGGGTAGCT[G/T]AACCTGACGCACCTATAGACTACTGCTACGTACGGCCAAATCACATCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t8nhkg4y