rrbp1

Ensembl ID:
ENSDARG00000041703
ZFIN ID:
ZDB-GENE-030429-36
Description:
ribosome binding protein 1 homolog [Source:RefSeq peptide;Acc:NP_955463]
Human Orthologue:
RRBP1
Human Description:
ribosome binding protein 1 homolog 180kDa (dog) [Source:HGNC Symbol;Acc:10448]
Mouse Orthologue:
Rrbp1
Mouse Description:
ribosome binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1932395]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32402 Nonsense Mutation detected in F1 DNA During 2016
sa14710 Nonsense Available for shipment Available now
sa797 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 45 978 2 26
Genomic Location:
Chromosome 22 (position 25561615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAACATTCTCCATGAAGGAGACATCTTACGAGGAAGCCCTGGCCAAA[C/T]AACGACAAGACTCAGGCAAGACCCAATCCCAACGCTCCGATAAGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 239 978 3 26
Genomic Location:
Chromosome 22 (position 25562303)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAAGCRGTTTCTGTGGAGGAGGTTGATATCCCTCAGCCGTCACCATA[T/G]AAGACTCTGGTCTCCAGTCTAAATAGTGCATYGTTCAGTGAGTCYGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 438 978 7 26
Genomic Location:
Chromosome 22 (position 25564047)
KASP Assay ID:
554-0702.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATCGAGAGCTGAAGGAGYGTACAGCCWCTCAGCAGTYTGAGGAAGAG[C/T]GAAGGAAGAGTCTTGAAACMAAGTTGGCGGCTGCTGAAGAACAGTTAAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link