rrbp1

Ensembl ID:
ENSDARG00000041703
ZFIN ID:
ZDB-GENE-030429-36
Description:
ribosome binding protein 1 homolog [Source:RefSeq peptide;Acc:NP_955463]
Human Orthologue:
RRBP1
Human Description:
ribosome binding protein 1 homolog 180kDa (dog) [Source:HGNC Symbol;Acc:10448]
Mouse Orthologue:
Rrbp1
Mouse Description:
ribosome binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1932395]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14710 Nonsense Available for shipment Available now
sa797 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 239 978 3 26
Genomic Location:
Chromosome 22 (position 25562303)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAAGCRGTTTCTGTGGAGGAGGTTGATATCCCTCAGCCGTCACCATA[T/G]AAGACTCTGGTCTCCAGTCTAAATAGTGCATYGTTCAGTGAGTCYGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 438 978 7 26
Genomic Location:
Chromosome 22 (position 25564047)
KASP Assay ID:
554-0702.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATCGAGAGCTGAAGGAGYGTACAGCCWCTCAGCAGTYTGAGGAAGAG[C/T]GAAGGAAGAGTCTTGAAACMAAGTTGGCGGCTGCTGAAGAACAGTTAAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s41d544c