rfx6

Ensembl ID:
ENSDARG00000041702
ZFIN ID:
ZDB-GENE-041014-299
Description:
DNA-binding protein RFX6 [Source:UniProtKB/Swiss-Prot;Acc:Q5RJA1]
Human Orthologue:
RFX6
Human Description:
regulatory factor X, 6 [Source:HGNC Symbol;Acc:21478]
Mouse Orthologue:
Rfx6
Mouse Description:
regulatory factor X, 6 Gene [Source:MGI Symbol;Acc:MGI:2445208]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17912 Nonsense Available for shipment Available now
sa18622 Essential Splice Site Available for shipment Available now
sa23789 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061122 Nonsense 35 848 1 18
ENSDART00000132310 Nonsense 28 841 1 18
Genomic Location:
Chromosome 20 (position 42565782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGAAGACCTGGGCCATCTGGATTATTCCAAGYCATTCGCTGCRAAA[C/T]AAACGCAGCCAAAGAAAAGCATCAGTCAGATCATCAAGGACAAGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061122 Essential Splice Site 121 848 3 18
ENSDART00000132310 Essential Splice Site 114 841 3 18
Genomic Location:
Chromosome 20 (position 42563434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNAATTTCCTCTTCTWACAACAMGAAGGCTTGGAACCAGAGGCCATTCAAA[G/A]TAAGATAGGCCAGGTTTCTGACTCAAAAACATCATTTAGTGCTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061122 Nonsense 318 848 10 18
ENSDART00000132310 Nonsense 311 841 10 18
Genomic Location:
Chromosome 20 (position 42557376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAAGAAAGTGCCGATAGCAAGACGATTTGTGTCGTCCTTAAAGAGA[C/T]AGACCTCATTTTTACATCTCGCACAGGTACAGACACTTCTATAATTCTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Genome-wide association study identifies five new susceptibility loci for prostate cancer in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bkn9z3h8