piwil1

Ensembl ID:
ENSDARG00000041699
ZFIN ID:
ZDB-GENE-030813-2
Description:
Piwi-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q8UVX0]
Human Orthologues:
PIWIL1, PIWIL3
Human Descriptions:
piwi-like 1 (Drosophila) [Source:HGNC Symbol;Acc:9007]
piwi-like 3 (Drosophila) [Source:HGNC Symbol;Acc:18443]
Mouse Orthologue:
Piwil1
Mouse Description:
piwi-like homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1928897]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8531 Nonsense Mutation detected in F1 DNA During 2017
sa7619 Missense Mutation detected in F1 DNA During 2017
hu4333 Nonsense Confirmed mutation in F2 line Unknown
hu2479 Nonsense Confirmed mutation in F2 line Unknown
sa30904 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061115 Nonsense 128 858 4 20
ENSDART00000133021   None 231 None 7
ENSDART00000138019 Nonsense 128 858 5 21
ENSDART00000139249   None 180 None 5
ENSDART00000145076 Nonsense 128 373 6 12

The following transcripts of ENSDARG00000041699 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45902300)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44241189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGGGCCAATTTYATGCGTCTGCTTTCACGTCCTATGTGGGCTTTRTA[T/A]CAGTATCATGTGGACTAMAAGCCACCAATGGAGTCCAGACGACTGCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061115 Missense 155 858 4 20
ENSDART00000133021   None 231 None 7
ENSDART00000138019 Missense 155 858 5 21
ENSDART00000139249   None 180 None 5
ENSDART00000145076 Missense 155 373 6 12

The following transcripts of ENSDARG00000041699 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45902380)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44241109
KASP Assay ID:
554-4021.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTCCAGACGACTGCGTTCGGCTTTGCTTTTCCAGCACGAGGAGACTC[T/A]GGGGAAAGCACACACCTTTGATGGAGCCATTCTCTTTCTCCCCAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu4333
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061115 Nonsense 544 858 13 20
ENSDART00000133021 Nonsense 222 231 7 7
ENSDART00000138019 Nonsense 544 858 14 21
ENSDART00000139249 Nonsense 135 180 4 5
ENSDART00000145076   None 373 None 12

The following transcripts of ENSDARG00000041699 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45906712)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44236777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGATTGAGTATGAAGATCGTCAGGAATCTCTCCTTAGAGCTTTGCAA[C/T]AAAACGTAGCACGTGAAACTCAGATGGTAAGTCGAGTATTCATGTAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2479
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061115 Nonsense 544 858 13 20
ENSDART00000133021 Nonsense 222 231 7 7
ENSDART00000138019 Nonsense 544 858 14 21
ENSDART00000139249 Nonsense 135 180 4 5
ENSDART00000145076   None 373 None 12

The following transcripts of ENSDARG00000041699 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45906712)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44236777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGATTGAGTATGAAGATCGTCAGGAATCTCTCCTTAGAGCTTTGCAA[C/T]AAAACGTAGCACGTGAAACTCAGATGGTAAGTCGAGTATTCATGTAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061115 Nonsense 565 858 14 20
ENSDART00000133021   None 231 None 7
ENSDART00000138019 Nonsense 565 858 15 21
ENSDART00000139249 Nonsense 156 180 5 5
ENSDART00000145076   None 373 None 12

The following transcripts of ENSDARG00000041699 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45906849)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44236640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCTCTGTAGGTGGTGGTGATCTTGCCTACCAATCGAAAAGACAAGTA[C/A]GACTGTGTAAAGAAGTACCTGTGTGTGGACTGCCCTACTCCTAGTCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link