bhlhe41

Ensembl ID:
ENSDARG00000041691
ZFIN ID:
ZDB-GENE-050419-146
Description:
class E basic helix-loop-helix protein 41 [Source:RefSeq peptide;Acc:NP_001034196]
Human Orthologue:
BHLHE41
Human Description:
basic helix-loop-helix family, member e41 [Source:HGNC Symbol;Acc:16617]
Mouse Orthologue:
Bhlhe41
Mouse Description:
basic helix-loop-helix family, member e41 Gene [Source:MGI Symbol;Acc:MGI:1930704]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2955 Essential Splice Site F2 line generated During 2014
sa10095 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2955
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061106 Essential Splice Site 42 421 2 5
Genomic Location:
Chromosome 18 (position 15785352)
KASP Assay ID:
554-2706.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTACATGTGCAAATCCAAAAGGGGGATGAAGAGAGAGGAAGGAAAGG[T/A]AAGCAAACTGTGGACCCGTGATGAAAACGTGACATTCACGTAACACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061106 Nonsense 328 421 5 5
Genomic Location:
Chromosome 18 (position 15787257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCATACATGCCTTTATTTGACAAAAGTCATTTGGAGAAGTTGGTGTA[T/A]CCAGCAGCAGCGGCGGCGGCATTGACCACACCATTTCCATGGCTTTACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wrktg7u0