usf1

Ensembl ID:
ENSDARG00000041689
ZFIN ID:
ZDB-GENE-040426-1072
Description:
upstream transcription factor 1 [Source:RefSeq peptide;Acc:NP_956590]
Human Orthologue:
USF1
Human Description:
upstream transcription factor 1 [Source:HGNC Symbol;Acc:12593]
Mouse Orthologue:
Usf1
Mouse Description:
upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8978 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10575 Nonsense Available for shipment Available now
sa22630 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019636 Essential Splice Site 20 309 3 11
ENSDART00000132373 Essential Splice Site 20 205 3 9
ENSDART00000133821 Essential Splice Site 20 90 3 5
ENSDART00000138676 Essential Splice Site 20 248 3 10
ENSDART00000142070 Essential Splice Site 20 156 3 7
ENSDART00000142902 None None 230 None 7
ENSDART00000143643 Essential Splice Site 20 299 3 11
ENSDART00000143990 Essential Splice Site 20 213 3 9
ENSDART00000144901 Essential Splice Site 20 224 3 9
ENSDART00000146967 Essential Splice Site 20 237 3 9
Genomic Location:
Chromosome 15 (position 20214934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCGAAAAGTTCTGARCCTGATGTCAGTRTTCCAGTCATTGAAGAAGG[T/C]ATTATCAGGTTACTTGTAAAGCAGCATTATGAGTTTTTTAAAATATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019636 Nonsense 254 309 10 11
ENSDART00000132373 None None 205 None 9
ENSDART00000133821 None None 90 None 5
ENSDART00000138676 Nonsense 242 248 10 10
ENSDART00000142070 None None 156 None 7
ENSDART00000142902 Nonsense 175 230 6 7
ENSDART00000143643 Nonsense 244 299 10 11
ENSDART00000143990 None None 213 None 9
ENSDART00000144901 None None 224 None 9
ENSDART00000146967 None None 237 None 9
Genomic Location:
Chromosome 15 (position 20220145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTAAAGGTGGGATCCTATCAAAGGCCTGTGATTACATTCAAGAGCTT[C/T]GACAAAGTAAYAGCCGGTTAGGAGATGAGCTGAACAGCATTGAGAGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019636 Nonsense 275 309 10 11
ENSDART00000132373 None None 205 None 9
ENSDART00000133821 None None 90 None 5
ENSDART00000138676 None None 248 10 10
ENSDART00000142070 None None 156 None 7
ENSDART00000142902 Nonsense 196 230 6 7
ENSDART00000143643 Nonsense 265 299 10 11
ENSDART00000143990 None None 213 None 9
ENSDART00000144901 None None 224 None 9
ENSDART00000146967 None None 237 None 9
Genomic Location:
Chromosome 15 (position 20220208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGTTAGGAGATGAGCTGAACAGCATTGAGAGGTTGAGGATGGATAAC[C/T]AGCTGTTACGACAAGAGGTATTTTATTGGATTCAGTGACAAACTAAATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8c9ph3sb