A2ML1 (4 of 15)

Ensembl ID:
ENSDARG00000041685
Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16120 Essential Splice Site Available for shipment Available now
sa32029 Nonsense Mutation detected in F1 DNA During 2016
sa42533 Nonsense Mutation detected in F1 DNA During 2016
sa42532 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2817 Nonsense F2 line generated During 2016
sa35872 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24980 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16992 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Essential Splice Site 29 1452 2 35
Genomic Location (Zv9):
Chromosome 15 (position 20200239)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21302865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATTAGAACATGRAAATTTAACAATACTGYAYGATTATTTCTTTCAAC[A/T]GATCTTTCATGGTGATATTTCCTGCTGTGATTGAGTCTGGATCTGAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Nonsense 681 1452 16 35
Genomic Location (Zv9):
Chromosome 15 (position 20195136)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21297762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTGGGGCTGAAAATGGCTTCAAATTTGTTTGTGCGAGTCCCTGAGTG[T/A]CTGTCATACAGAGGCCTGACTTATCACAGAAAAATAGGTACCTGTACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Nonsense 1021 1452 25 35
Genomic Location (Zv9):
Chromosome 15 (position 20185845)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21288471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATTAACCATTATGTCACTTAACAGGATACCAGAGACAACTGAACTAC[A/T]AGCATTTTGATGGGGCTTACAGCACATTTGGTTATGGTGATGGGAATACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Essential Splice Site 1115 1452 27 35
Genomic Location (Zv9):
Chromosome 15 (position 20185223)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21287849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGCCTACATTACTGCATCACTGCTTGAACTGGAAACTCCAGTCACAG[T/G]AAGTTCATCATCAGGAAACTCAGTATAAACTCTTAGTAAAATGATACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2817
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Nonsense 1150 1452 28 35
Genomic Location (Zv9):
Chromosome 15 (position 20185041)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21287667
KASP Assay ID:
554-3224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAACACTTACACCACTGCTCTGCTGGCCTACACTTTCAGTCTGGCC[A/T]GAGACACCAACACTCGACAGCAGCTTTTCAACAAACTGGAGGATCTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Essential Splice Site 1234 1452 29 35
Genomic Location (Zv9):
Chromosome 15 (position 20184703)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21287329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGCTTGTGAAGCAGCAAAATGCCTATGGAGGATTCTCCTCCACACAG[G/A]TTCCTCAAATCAGACACATTATTGCTGAATGGCTAAAATTGTCACATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Essential Splice Site 1306 1452 31 35
Genomic Location (Zv9):
Chromosome 15 (position 20184309)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21286935
KASP Assay ID:
554-7531.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAGATGCTTTGATGATGGTTAAGAATGTGTTTGTTTTGACTCTCTC[A/T]GATGGCTCAGTTCTACAACATTCTCACTCCTACTGAAGCTAAAACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Nonsense 1347 1452 32 35
Genomic Location (Zv9):
Chromosome 15 (position 20184085)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21286711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTATTCATCATTAACTCTGATGATTCTTGTGTTTGTGTTTTMCAGATA[T/G]GATGGTCCACAGGCCAARACTAACATGGTTATTGTGGACATTAAACTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link