A2ML1 (4 of 15)

Ensembl ID:
ENSDARG00000041685
Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16120 Essential Splice Site Available for shipment Available now
sa2817 Nonsense F2 line generated During 2014
sa24980 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16992 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Essential Splice Site 29 1452 2 35
Genomic Location:
Chromosome 15 (position 20200239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATTAGAACATGRAAATTTAACAATACTGYAYGATTATTTCTTTCAAC[A/T]GATCTTTCATGGTGATATTTCCTGCTGTGATTGAGTCTGGATCTGAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2817
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Nonsense 1150 1452 28 35
Genomic Location:
Chromosome 15 (position 20185041)
KASP Assay ID:
554-3224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAACACTTACACCACTGCTCTGCTGGCCTACACTTTCAGTCTGGCC[A/T]GAGACACCAACACTCGACAGCAGCTTTTCAACAAACTGGAGGATCTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Essential Splice Site 1306 1452 31 35
Genomic Location:
Chromosome 15 (position 20184309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAGATGCTTTGATGATGGTTAAGAATGTGTTTGTTTTGACTCTCTC[A/T]GATGGCTCAGTTCTACAACATTCTCACTCCTACTGAAGCTAAAACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061098 Nonsense 1347 1452 32 35
Genomic Location:
Chromosome 15 (position 20184085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTATTCATCATTAACTCTGATGATTCTTGTGTTTGTGTTTTMCAGATA[T/G]GATGGTCCACAGGCCAARACTAACATGGTTATTGTGGACATTAAACTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/we0w4k0f