sb:cb37

Ensembl ID:
ENSDARG00000041645
ZFIN ID:
ZDB-GENE-030131-9800
Description:
Sb:cb37 protein [Source:UniProtKB/TrEMBL;Acc:A4QNS8]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22628 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046443 Essential Splice Site 1004 1445 23 34
Genomic Location (Zv9):
Chromosome 15 (position 20102090)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21204716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTCACATCAGCCATACGAGAGAAAGCCAGCAGCTTCCTTAAGAGTGG[T/G]GAGACACATCAGTCATGATGAGAAACTACTGAGATGGAAAAATTATTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link