mt2

Ensembl ID:
ENSDARG00000041623
ZFIN IDs:
ZDB-GENE-030131-4174, ZDB-GENE-990415-159
Description:
Metallothionein-2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZSY6]
Human Orthologues:
MT1A, MT1B, MT1CP, MT1E, MT1F, MT1G, MT1H, MT1M, MT1X, MT2A, MT3, MT4
Human Descriptions:
metallothionein 1A [Source:HGNC Symbol;Acc:7393]
metallothionein 1B [Source:HGNC Symbol;Acc:7394]
metallothionein 1C (pseudogene) [Source:HGNC Symbol;Acc:7395]
metallothionein 1E [Source:HGNC Symbol;Acc:7397]
metallothionein 1F [Source:HGNC Symbol;Acc:7398]
metallothionein 1G [Source:HGNC Symbol;Acc:7399]
metallothionein 1H [Source:HGNC Symbol;Acc:7400]
metallothionein 1M [Source:HGNC Symbol;Acc:14296]
metallothionein 1X [Source:HGNC Symbol;Acc:7405]
metallothionein 2A [Source:HGNC Symbol;Acc:7406]
metallothionein 3 [Source:HGNC Symbol;Acc:7408]
metallothionein 4 [Source:HGNC Symbol;Acc:18705]
Mouse Orthologues:
Mt1, Mt2, Mt3, Mt4
Mouse Descriptions:
metallothionein 1 Gene [Source:MGI Symbol;Acc:MGI:97171]
metallothionein 2 Gene [Source:MGI Symbol;Acc:MGI:97172]
metallothionein 3 Gene [Source:MGI Symbol;Acc:MGI:97173]
metallothionein 4 Gene [Source:MGI Symbol;Acc:MGI:99692]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4747 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061007 Nonsense 24 60 2 3
Genomic Location:
Chromosome 18 (position 17194042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGWAGCTGGAACTTGCAACTGTGGTGCYACCTGCAAGTGCACTAATTGC[C/T]AGTGTACTACCTGCAAGAAGAGTATGTATTTGCCTTTTTAAGTTCCTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Gambling: Genome-wide association study of a quantitative disordered gambling trait. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o55xjbdi