bbs2

Ensembl ID:
ENSDARG00000041621
ZFIN ID:
ZDB-GENE-020801-1
Description:
Bardet-Biedl syndrome 2 protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q98SP7]
Human Orthologue:
BBS2
Human Description:
Bardet-Biedl syndrome 2 [Source:HGNC Symbol;Acc:967]
Mouse Orthologue:
Bbs2
Mouse Description:
Bardet-Biedl syndrome 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2135267]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa172 Nonsense Confirmed mutation in F2 line During 2014
sa2952 Nonsense Available for shipment Available now
sa248 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa172
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061000 Nonsense 48 715 3 18
Genomic Location:
Chromosome 18 (position 17188405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTTATTTTTAAACCTATCCAGGTGTTTATCCACAACCCTCACACT[C/T]GAGCCCAGAGACCAACAGCCCACCGGTTGAGTCAAAGCACCCAGGACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061000 Nonsense 353 715 10 18
ENSDART00000061000 Nonsense 353 715 10 18
Genomic Location:
Chromosome 18 (position 17183870)
KASP Assay ID:
554-2602.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGATCAGAGAGCTGAGTCAACGGAAACAGAACTTGATGCTYGAGTTR[C/T]GAAACTATGAGGAAAATGCCAAGGTTAGACATGCTATTCAAGTGATSCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa248
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061000 Nonsense 353 715 10 18
ENSDART00000061000 Nonsense 353 715 10 18
Genomic Location:
Chromosome 18 (position 17183870)
KASP Assay ID:
554-2602.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGATCAGAGAGCTGAGTCAACGGAAACAGAACTTGATGCTYGAGTTR[C/T]GAAACTATGAGGAAAATGCCAAGGTTAGACATGCTATTCAAGTGATSCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wbxbzbxi