gnb2l1

Ensembl ID:
ENSDARG00000041619
ZFIN ID:
ZDB-GENE-990415-89
Description:
Guanine nucleotide-binding protein subunit beta-2-like 1 [Source:UniProtKB/Swiss-Prot;Acc:O42248]
Human Orthologues:
APAF1, GNB2L1, WDR88
Human Descriptions:
apoptotic peptidase activating factor 1 [Source:HGNC Symbol;Acc:576]
guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 [Source:HGNC Symbol;Acc:43
WD repeat domain 88 [Source:HGNC Symbol;Acc:26999]
Mouse Orthologues:
Apaf1, Gnb2l1
Mouse Descriptions:
apoptotic peptidase activating factor 1 Gene [Source:MGI Symbol;Acc:MGI:1306796]
guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28257 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061001 Nonsense 177 317 5 8
Genomic Location (Zv9):
Chromosome 14 (position 6917170)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6644239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTCCTACATCGGGTGATCATTTGCTAATGCATGTGTTTTAGGTATG[G/A]AATTTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACCGGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link