adarb1

Ensembl ID:
ENSDARG00000041609
ZFIN ID:
ZDB-GENE-000627-2
Description:
adenosine deaminase, RNA-specific, B1 [Source:RefSeq peptide;Acc:NP_571685]
Human Orthologue:
ADARB1
Human Description:
adenosine deaminase, RNA-specific, B1 [Source:HGNC Symbol;Acc:226]
Mouse Orthologue:
Adarb1
Mouse Description:
adenosine deaminase, RNA-specific, B1 Gene [Source:MGI Symbol;Acc:MGI:891999]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14549 Nonsense Available for shipment Available now
sa37456 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044574 Nonsense 421 720 7 12
ENSDART00000129768 Nonsense 390 689 6 11
Genomic Location (Zv9):
Chromosome 22 (position 12790625)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12626555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGGACTGGCCCTTAAYGACTGCCATGCTGAGATCATCGCACGGCGCT[C/A]ACTCATTAGATACCTGTACAATCAGCTGGAATACTTCCTCAGGTATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044574 Essential Splice Site 662 720 11 12
ENSDART00000129768 Essential Splice Site 631 689 10 11
Genomic Location (Zv9):
Chromosome 22 (position 12784697)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12620627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTTGCAAACACGCTCTTTACAGTCGTTGGGTCTGTCTACATGCAAAG[G/A]TAAAACATTTGTTAAGGTTTTAAAGGATAAATGACATTTAGGGTGTTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link