eif4ebp3l

Ensembl ID:
ENSDARG00000041607
ZFIN ID:
ZDB-GENE-030826-26
Description:
Eukaryotic translation initiation factor 4E-binding protein 3-like [Source:UniProtKB/Swiss-Prot;Acc:
Human Orthologues:
EIF4EBP1, EIF4EBP2, EIF4EBP3
Human Descriptions:
eukaryotic translation initiation factor 4E binding protein 1 [Source:HGNC Symbol;Acc:3288]
eukaryotic translation initiation factor 4E binding protein 2 [Source:HGNC Symbol;Acc:3289]
eukaryotic translation initiation factor 4E binding protein 3 [Source:HGNC Symbol;Acc:3290]
Mouse Orthologues:
Eif4ebp1, Eif4ebp2, Eif4ebp3
Mouse Descriptions:
eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267
eukaryotic translation initiation factor 4E binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:109198
eukaryotic translation initiation factor 4E binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:127084

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22422 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060990 Nonsense 88 112 2 3
Genomic Location:
Chromosome 14 (position 6942036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCAGATTCCAGGAGTGACCATTCCTTCACTCCACCCCGTGTCCAAAT[T/A]GCAGGAGCTCAAAGAGGAACTGGAGGAGGAGAAAGAGCTGGCAGGTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4k497uy0