ces3

Ensembl ID:
ENSDARG00000041595
ZFIN ID:
ZDB-GENE-030131-9563
Description:
carboxylesterase 3 [Source:RefSeq peptide;Acc:NP_001038401]
Human Orthologues:
CES1, CES2, CES3, CES4A, CES5A
Human Descriptions:
carboxylesterase 1 [Source:HGNC Symbol;Acc:1863]
carboxylesterase 2 [Source:HGNC Symbol;Acc:1864]
carboxylesterase 3 [Source:HGNC Symbol;Acc:1865]
carboxylesterase 4A [Source:HGNC Symbol;Acc:26741]
carboxylesterase 5A [Source:HGNC Symbol;Acc:26459]
Mouse Orthologues:
AC166833.1, Ces1a, Ces1b, Ces1c, Ces1d, Ces1e, Ces1f, Ces1g, Ces1h, Ces2a, Ces2b, Ces2c, Ces2d-ps, Ces2e, Ces2f, Ces2g, Ces3a, Ces3b, Ces4a, Ces5a, Ces5a
Mouse Descriptions:
carboxyesterase 2B Gene [Source:MGI Symbol;Acc:MGI:2448547]
carboxylesterase 1A Gene [Source:MGI Symbol;Acc:MGI:3648919]
carboxylesterase 1B Gene [Source:MGI Symbol;Acc:MGI:3779470]
carboxylesterase 1C Gene [Source:MGI Symbol;Acc:MGI:95420]
carboxylesterase 1D Gene [Source:MGI Symbol;Acc:MGI:2148202]
carboxylesterase 1E Gene [Source:MGI Symbol;Acc:MGI:95432]
carboxylesterase 1F Gene [Source:MGI Symbol;Acc:MGI:2142687]
carboxylesterase 1G Gene [Source:MGI Symbol;Acc:MGI:88378]
carboxylesterase 1H Gene [Source:MGI Symbol;Acc:MGI:1922954]
carboxylesterase 2A Gene [Source:MGI Symbol;Acc:MGI:2142491]
carboxylesterase 2C Gene [Source:MGI Symbol;Acc:MGI:2385905]
carboxylesterase 2D, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:3704319]
carboxylesterase 2E Gene [Source:MGI Symbol;Acc:MGI:2443170]
carboxylesterase 2F Gene [Source:MGI Symbol;Acc:MGI:1919153]
carboxylesterase 2G Gene [Source:MGI Symbol;Acc:MGI:1919611]
carboxylesterase 3A Gene [Source:MGI Symbol;Acc:MGI:102773]
carboxylesterase 3B Gene [Source:MGI Symbol;Acc:MGI:3644960]
carboxylesterase 4A Gene [Source:MGI Symbol;Acc:MGI:2384581]
carboxylesterase 5A Gene [Source:MGI Symbol;Acc:MGI:1915185]
carboxylesterase 5A Gene [Source:MGI Symbol;Acc:MGI:1915185]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23271 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043715 Nonsense 521 556 14 14
ENSDART00000100213 None None 285 None 7
ENSDART00000126926 Nonsense 517 552 14 14
ENSDART00000140191 Nonsense 514 549 13 13
Genomic Location:
Chromosome 18 (position 17085304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAATCCCGCTCCAGTGCCCTGGCCTGTTTACGACCAGTCTAATAAGTA[C/A]TTGAACCTGGGATTGCAGCAAACTGAGGGACAAGGCCTCAAGAAGGACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5u8ec052