mrpl39

Ensembl ID:
ENSDARG00000041570
ZFIN ID:
ZDB-GENE-030131-6520
Description:
39S ribosomal protein L39, mitochondrial [Source:RefSeq peptide;Acc:NP_956209]
Human Orthologue:
MRPL39
Human Description:
mitochondrial ribosomal protein L39 [Source:HGNC Symbol;Acc:14027]
Mouse Orthologue:
Mrpl39
Mouse Description:
mitochondrial ribosomal protein L39 Gene [Source:MGI Symbol;Acc:MGI:1351620]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8652 Nonsense Mutation detected in F1 DNA During 2014
sa24833 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060944 Nonsense 46 342 12 20
ENSDART00000147633 Nonsense 46 342 2 10

The following transcripts of ENSDARG00000041570 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 457036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTTCTGGCTCAGCGCAGTGCTCAGTTCTCCAGAGAGCAGCTCCGYCAG[C/T]GAGCGCTGCAGCCGCGGGTGGAGAAGGTGGAGGTGCAGCTGCAGGGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060944 Nonsense 182 342 15 20
ENSDART00000147633 Nonsense 182 342 5 10

The following transcripts of ENSDARG00000041570 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 461924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGTGCTTTCTGCTGTGATCTGCTTCTGGATCCGCTTCTGGACTCCTG[G/A]AAGCCCACAGAGGTCAGAAACACCTCCTCAACACTGATTTATTCTCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2w8sxu3c