tnfaip1

Ensembl ID:
ENSDARG00000041565
ZFIN ID:
ZDB-GENE-030131-5610
Description:
BTB/POZ domain-containing protein TNFAIP1 [Source:RefSeq peptide;Acc:NP_956093]
Human Orthologue:
TNFAIP1
Human Description:
tumor necrosis factor, alpha-induced protein 1 (endothelial) [Source:HGNC Symbol;Acc:11894]
Mouse Orthologue:
Tnfaip1
Mouse Description:
tumor necrosis factor, alpha-induced protein 1 (endothelial) Gene [Source:MGI Symbol;Acc:MGI:104961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11425 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060935 Nonsense 255 320 7 7
ENSDART00000137926 None None 180 None 6
ENSDART00000140087 None None 242 None 6

The following transcripts of ENSDARG00000041565 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 19502028)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTAAGAGGAACTCTTGTAATCCCCTCAGGTTGAGTTTCCAGAAGCA[C/T]GAATCTACGAGGAGACGCTAAACGCCTTGCTCTATGAGACTCTCCCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ytt3ep7n