si:dkey-102f14.5

Ensembl ID:
ENSDARG00000041560
ZFIN ID:
ZDB-GENE-060503-705
Description:
lin-10 [Source:RefSeq peptide;Acc:NP_001076282]
Human Orthologue:
C16orf70
Human Description:
chromosome 16 open reading frame 70 [Source:HGNC Symbol;Acc:29564]
Mouse Orthologue:
D230025D16Rik
Mouse Description:
RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4746 Nonsense F2 line generated During 2017
sa2954 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa4746
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090754 Nonsense 149 425 6 16
Genomic Location (Zv9):
Chromosome 18 (position 17156281)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17508047
KASP Assay ID:
554-3550.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTTTCTTTCTCCTTCCAGCTGGACTCCTGGAGTGAAGCCCCTAAATA[T/A]GAGGTAAGACTGCTTTCATACRCTTAATACCACGGCTCGGATTGACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2954
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090754 Nonsense 222 425 9 16
Genomic Location (Zv9):
Chromosome 18 (position 17160497)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17512263
KASP Assay ID:
554-2672.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATGCTTCTTTGTCCCACAATTYGTGTTATTTGACTTTTTCCAGGATG[C/A]GGCCCWGGAGTRCTGGCTGATACTAAAGTGCGAGCCGTAGAGAGAAGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link