si:dkey-14a7.1

Ensembl ID:
ENSDARG00000041554
ZFIN ID:
ZDB-GENE-041014-304
Description:
Protein unc-93 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q5SPF7]
Human Orthologue:
UNC93A
Human Description:
unc-93 homolog A (C. elegans) [Source:HGNC Symbol;Acc:12570]
Mouse Orthologues:
Gm8597, Gm9992, Unc93a
Mouse Descriptions:
predicted gene 8597 Pseudogene [Source:MGI Symbol;Acc:MGI:3779808]
predicted gene 9992 Gene [Source:MGI Symbol;Acc:MGI:3712668]
unc-93 homolog A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1933250]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30719 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060915 Nonsense 447 467 8 8
ENSDART00000142486 Nonsense 445 465 8 8
Genomic Location (Zv9):
Chromosome 20 (position 43421104)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43492263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACAACGAGTACAAGCATCCGACTCCACAAGTTACTGAGGACTTCCTC[A/T]AACCAATCAAGCCCAAGCTGAAAGACGACAAAGAAGACAATATTATTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link