si:dkey-14a7.2

Ensembl ID:
ENSDARG00000041550
ZFIN ID:
ZDB-GENE-041014-153
Description:
Novel protein similar to vertebrate PIM family oncogenes [Source:UniProtKB/TrEMBL;Acc:Q5SPF5]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23795 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060910 Nonsense 542 560 6 7
ENSDART00000133492   None 220 None 3
Genomic Location (Zv9):
Chromosome 20 (position 43432514)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43503673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAATGCAATGATTTCCTCTGCAGTTGTCTGGAAATTAACTACCCTTTT[C/T]GACCCAAGTTGCATGCACTCCTTGACCATGCCTGGTTTAAGGTAATGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link