ppih

Ensembl ID:
ENSDARG00000041530
ZFIN ID:
ZDB-GENE-040625-127
Description:
peptidyl-prolyl cis-trans isomerase H isoform 2 [Source:RefSeq peptide;Acc:NP_957499]
Human Orthologue:
PPIH
Human Description:
peptidylprolyl isomerase H (cyclophilin H) [Source:HGNC Symbol;Acc:14651]
Mouse Orthologue:
Ppih
Mouse Description:
peptidyl prolyl isomerase H Gene [Source:MGI Symbol;Acc:MGI:106499]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21383 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060877 Essential Splice Site 44 177 3 10
ENSDART00000060880 Essential Splice Site 44 213 3 12
ENSDART00000060883 Essential Splice Site 44 181 2 9
ENSDART00000147606 Essential Splice Site 44 189 2 9
Genomic Location (Zv9):
Chromosome 8 (position 49334486)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47187881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAGAGCTTTTCGCTGACATCGTTCCAAAGACTGCAGAAAATTTTCGG[T/C]AAGACTGCATAAATCAGGGGTGTCAAACGGACGGCTCGCAAACGTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link