itm2bb

Ensembl ID:
ENSDARG00000041505
ZFIN ID:
ZDB-GENE-040426-2139
Description:
integral membrane protein 2Bb [Source:RefSeq peptide;Acc:NP_998141]
Human Orthologue:
ITM2B
Human Description:
integral membrane protein 2B [Source:HGNC Symbol;Acc:6174]
Mouse Orthologue:
Itm2b
Mouse Description:
integral membrane protein 2B Gene [Source:MGI Symbol;Acc:MGI:1309517]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13204 Nonsense Available for shipment Available now
sa41427 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34652 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101470 Nonsense 85 254 3 6

The following transcripts of ENSDARG00000041505 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 26370790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGGAYCAGGTGTTTATCTGTGGGCTGAAGYACTACGAGGAAGACTA[T/A]GAGCTGAATGAAGAGGTGGACCYAGAAATTGGAGCACCGCTGAGGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101470 Essential Splice Site 175 254 4 6

The following transcripts of ENSDARG00000041505 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 26374476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTGTAATGCCACCAAGAGACTTTCAGGAGTTCCTGGTCAACATCAAG[G/A]TAAGCATCCAGAATAAAAGTCAGTGAGGGATTCTCGTGTCTTTTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101470 Essential Splice Site 176 254 5 6

The following transcripts of ENSDARG00000041505 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 26374561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTCTTTTTTCACACTAAATGAATTTTGTGTGTGTGTGTGTTTTTGCA[G/A]GAAGGAATGTATCTTCCTCAGACATACCTGATCCATGAGGAGATGATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link