med4

Ensembl ID:
ENSDARG00000041503
ZFIN ID:
ZDB-GENE-050417-438
Description:
Mediator of RNA polymerase II transcription subunit 4 [Source:UniProtKB/Swiss-Prot;Acc:Q561X3]
Human Orthologue:
MED4
Human Description:
mediator complex subunit 4 [Source:HGNC Symbol;Acc:17903]
Mouse Orthologue:
Med4
Mouse Description:
mediator of RNA polymerase II transcription, subunit 4 homolog (yeast) Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41426 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060840 Essential Splice Site 48 254 2 7
ENSDART00000128197 Essential Splice Site 56 262 2 7
Genomic Location (Zv9):
Chromosome 9 (position 26361398)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25517184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGCTGTCCAGGTCACAGAAACTGCCCCCGCCTGGCGAGGACACACTG[G/A]TGAGAGTCAATGCTGTTTACACACATACACATACACATCCCATGCCCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link