tgfb1a

Ensembl ID:
ENSDARG00000041502
ZFIN ID:
ZDB-GENE-030618-1
Description:
transforming growth factor, beta 1a [Source:RefSeq peptide;Acc:NP_878293]
Human Orthologue:
TGFB1
Human Description:
transforming growth factor, beta 1 [Source:HGNC Symbol;Acc:11766]
Mouse Orthologue:
Tgfb1
Mouse Description:
transforming growth factor, beta 1 Gene [Source:MGI Symbol;Acc:MGI:98725]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16296 Essential Splice Site Available for shipment Available now
sa39024 Nonsense Mutation detected in F1 DNA During 2016
sa42471 Nonsense Mutation detected in F1 DNA During 2016
sa39023 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060839 Essential Splice Site 108 377 1 7
Genomic Location (Zv9):
Chromosome 15 (position 2794641)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2839705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGAGGACTAYTTTGGCAAGGAGGTGCATAAGTTCGTYTTCCAGCAAG[G/T]TTAGACATTTAAAGTACTTTTTTTTNNACTTCTTATTGTAGTATTCGATR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060839 Nonsense 275 377 4 7
Genomic Location (Zv9):
Chromosome 15 (position 2778752)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2823816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATCCGTTCGCAAGAAACGAGCTGTTGGCACCGATGAAACATGTGAT[G/T]AGTAAGTCTTTTTGCTGTCCTATGCTTTATATACAGCTGAAGTCACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060839 Nonsense 300 377 5 7
Genomic Location (Zv9):
Chromosome 15 (position 2776073)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2821137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCTTTACATTGACTTTCGGAAAGATCTGGGTTGGAAGTGGATCCAC[A/T]AGCCCAAGGGGTACTTTGCCAACTACTGCATGGGGTCCTGCACCTACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060839 Nonsense 320 377 5 7
Genomic Location (Zv9):
Chromosome 15 (position 2776013)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2821077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTACTTTGCCAACTACTGCATGGGGTCCTGCACCTACATCTGGAATGCT[G/T]AGAACAAATACTCACAGGTAGCCTGTTTTGTTTTGTTATTACTGTCCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link