si:ch211-196f5.1

Ensembl ID:
ENSDARG00000041493
ZFIN ID:
ZDB-GENE-041014-307
Description:
Novel protein similar to mouse and human importin 4 (IPO4) [Source:UniProtKB/TrEMBL;Acc:Q5RIS6]
Human Orthologue:
IPO4
Human Description:
importin 4 [Source:HGNC Symbol;Acc:19426]
Mouse Orthologue:
Ipo4
Mouse Description:
importin 4 Gene [Source:MGI Symbol;Acc:MGI:1923001]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37841 Nonsense Mutation detected in F1 DNA During 2017
sa17116 Essential Splice Site Available for shipment Available now
sa44103 Nonsense Mutation detected in F1 DNA During 2017
sa15131 Nonsense Available for shipment Available now
sa24457 Nonsense Available for shipment Available now
sa10254 Nonsense Available for shipment Available now
sa14017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039312 Nonsense 124 1085 5 30
ENSDART00000060826   None 345 None 8
Genomic Location (Zv9):
Chromosome 24 (position 12732957)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12684594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCATGAGACCCCGGACCGCTGGCCTGCTCTTCTTGAGTTATTAAAC[C/T]AGTCTACTAAAAGCAACAACCCACAGGATAGACAGGTAAACCCAACTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039312 Essential Splice Site 217 1085 7 30
ENSDART00000060826   None 345 None 8
Genomic Location (Zv9):
Chromosome 24 (position 12730914)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12682551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAWCCCCAAACTGCTCRTTGCTCTGAAACACCTCATTCAGGCAGACCAGG[T/C]GAGGAYACTTTGATAATCTCTTGCTGTGTTYATATGGTAATGCTTCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039312 Nonsense 460 1085 14 30
ENSDART00000060826   None 345 None 8
Genomic Location (Zv9):
Chromosome 24 (position 12703996)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12655633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAAAATTGGACACATGACGAAGGCCTTCTATGCCTTGGAGAACTTCT[T/A]GGAGAACTTGGGTTAGAATGCATACACAAAAATCTTTTCTTCAAAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039312 Nonsense 463 1085 14 30
ENSDART00000060826   None 345 None 8
Genomic Location (Zv9):
Chromosome 24 (position 12703987)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12655624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACACATGACGAAGGCCTTCTATGCCTTGGAGAACTTCTTGGAGAACT[T/A]GGGTTAGAATGCATACACAAAAWTCTTTTCTTCAAAAAAYRTTTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039312 Nonsense 465 1085 15 30
ENSDART00000060826   None 345 None 8
Genomic Location (Zv9):
Chromosome 24 (position 12701276)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12652913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTTCGTGACCCTTTAAATAATCACTGCTCTCTTTTTGTTATCAGGT[C/T]AAGAAATTGAGCCCTATCTTCCTTCTCTTATGGAGACCATGTTGTCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039312 Nonsense 626 1085 19 30
ENSDART00000060826   None 345 None 8
Genomic Location (Zv9):
Chromosome 24 (position 12697845)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12649482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTCATAATATTCCTGTCTATTCTATAGGCCCATTTAGATGAAGACAAA[C/T]AGTTTGTGCTCTTGGACGATGATGATGCTGATGATGGAGAAGAGGGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039312 Nonsense 850 1085 25 30
ENSDART00000060826 Nonsense 110 345 3 8
Genomic Location (Zv9):
Chromosome 24 (position 12670275)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12622012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAAGGGATTCCTGCYTTAGCCTCTRCTGTACCAGCTGAAACCTTCTA[C/A]CCTCACCTCAATGACCTGCTGCCCCTAATCATGAGCAAAACTGTGAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link