fzd1

Ensembl ID:
ENSDARG00000041464
ZFIN ID:
ZDB-GENE-990415-219
Description:
Zg03 [Source:UniProtKB/TrEMBL;Acc:Q90444]
Human Orthologue:
FZD1
Human Description:
frizzled homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:4038]
Mouse Orthologue:
Fzd1
Mouse Description:
frizzled homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1196625]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42834 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060789 Nonsense 256 511 2 2
Genomic Location (Zv9):
Chromosome 16 (position 57441827)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53895168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCGCCTACATCGCCGGATTTCTCCTGGAGGACAAGGTTGTCTGCAAC[G/T]AGCAGTTCGAGAACGAGTTCAGGACTGTGGTTCAGGGCACCAAGAAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link