rab11a

Ensembl ID:
ENSDARG00000041450
ZFIN ID:
ZDB-GENE-041114-53
Description:
ras-related protein Rab-11A [Source:RefSeq peptide;Acc:NP_001007360]
Human Orthologue:
RAB11A
Human Description:
RAB11A, member RAS oncogene family [Source:HGNC Symbol;Acc:9760]
Mouse Orthologue:
Rab11a
Mouse Description:
RAB11a, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1858202]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36627 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36628 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060766 Essential Splice Site 79 215 2 5
Genomic Location (Zv9):
Chromosome 18 (position 18915983)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19146206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTGGGACACGGCAGGACAGGAGCGCTACCGAGCCATCACTTCAGCG[T/A]AAGACTTATTACAGATTCCAGTTTTAAAGTTTAACTGCCTGTTCATAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060766 Essential Splice Site 144 215 4 5
Genomic Location (Zv9):
Chromosome 18 (position 18916744)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19146967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGAGGCATTAATCCATACTCTTCCACTTTTTTGCAACCATATTTGC[A/T]GAGAAAAACGGTCTGTCCTTCCTAGAGACCTCAGCTTTGGATTCCACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link