bmp2b

Ensembl ID:
ENSDARG00000041430
ZFIN ID:
ZDB-GENE-980526-474
Description:
bone morphogenetic protein 2 [Source:RefSeq peptide;Acc:NP_571435]
Human Orthologue:
BMP2
Human Description:
bone morphogenetic protein 2 [Source:HGNC Symbol;Acc:1069]
Mouse Orthologue:
Bmp2
Mouse Description:
bone morphogenetic protein 2 Gene [Source:MGI Symbol;Acc:MGI:88177]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18243 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100482 Nonsense 115 409 2 5
ENSDART00000131169 Nonsense 115 411 2 3
ENSDART00000100482 Nonsense 115 409 2 5
ENSDART00000131169 Nonsense 115 411 2 3
Genomic Location:
Chromosome 20 (position 46429654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTATGGGAAAACATGTAGAAAGGGCAGCCAGCAGAGCAAACAYGATA[C/T]GAAGTTTTCATCACGAAGGTGAGGCCTGATTTGATATTACAGCCTGAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. (View Study)
  • Colorectal cancer: Identification of Genetic Susceptibility Loci for Colorectal Tumors in a Genome-Wide Meta-analysis. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Sagittal craniosynostosis: A genome-wide association study identifies susceptibility loci for nonsyndromic sagittal craniosynostosis near BMP2 and within BBS9. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ahk9saai