ENSDARG00000041425

Ensembl ID:
ENSDARG00000041425
Human Orthologues:
DIRAS1, DIRAS2, DIRAS3, RAP1A, RAP1B, RAP2A, RAP2B, RAP2C
Human Descriptions:
DIRAS family, GTP-binding RAS-like 1 [Source:HGNC Symbol;Acc:19127]
DIRAS family, GTP-binding RAS-like 2 [Source:HGNC Symbol;Acc:19323]
DIRAS family, GTP-binding RAS-like 3 [Source:HGNC Symbol;Acc:687]
RAP1A, member of RAS oncogene family [Source:HGNC Symbol;Acc:9855]
RAP1B, member of RAS oncogene family [Source:HGNC Symbol;Acc:9857]
RAP2A, member of RAS oncogene family [Source:HGNC Symbol;Acc:9861]
RAP2B, member of RAS oncogene family [Source:HGNC Symbol;Acc:9862]
RAP2C, member of RAS oncogene family [Source:HGNC Symbol;Acc:21165]
Mouse Orthologues:
Diras1, Diras2, Gm266, Rap1a, Rap1b, Rap2a, Rap2b, Rap2c
Mouse Descriptions:
DIRAS family, GTP-binding RAS-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183442]
DIRAS family, GTP-binding RAS-like 2 Gene [Source:MGI Symbol;Acc:MGI:1915453]
predicted gene 266 Gene [Source:MGI Symbol;Acc:MGI:2685112]
RAP2B, member of RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1921262]
RAP2C, member of RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1919315]
RAS related protein 1b Gene [Source:MGI Symbol;Acc:MGI:894315]
RAS related protein 2a Gene [Source:MGI Symbol;Acc:MGI:97855]
RAS-related protein-1a Gene [Source:MGI Symbol;Acc:MGI:97852]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11185 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060723 Essential Splice Site 60 99 1 2
Genomic Location:
Chromosome 11 (position 44696858)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCAGTACGTRGAGACCTCAGCCAAAACCAGAGCCAACGTCGATAAGG[T/C]GAACTATTCAGTTGAGACAGTGTGTCTGAGCCTCTGACATTATCAGGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoporosis: An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
  • Volumetric brain MRI: Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xf7q1y59